Description :
From Genome Similarity Track
Location :
Scaffold_89:99463- 106032
Transcript NameFunction/comments
Physo_140733reverse transcriptase

Sequence
6569 bases(100 bases per row)
CGGGCGCTGTTGTTAACAACAGCGCTCGTATTACTTTCCAGCGTGTAGCGCATGGTGGGCTTCGTACGCCCTCACCATGTCCGGGACGTCTTCGAGCAAG
ACGTTCCGCGGCTCCCATGTATCTTGGTTGGGAGGGAATCCTCTCCAACGGATACGAACACGAACCGGTTGCCTGTTCGTTCTCGGGATACTGTGACCAA
CAATCCGCTCAACTATCCATCGAGTTGAGCCGTGTGCGTCACGAATTGGCGACGGTGGTGGTGGAGACACGCCCCGTGTGTGGTCAACTTGGTGTCGACC
CTGATCTCGCGTCTCCCCACGACCGAGTTCCGGTCGTGGAGTAGTTCCAGAGCGCTGGGCGCTCTGAAGTATCCTCAGGTTGCGGCGGCCTTCCAGGCCG
CCTCGATCGTTCCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGACTTCGCGCTGGTGAGGATGACGGCTTCCGCCGAGTCTTCTGCTTC
GGTTCAGTCGAGCTAGGTAGCTCGTACTGCAGGTATGGCTTCAGCCGTCCGACGTAGAACGTCGGATGGAGGCGCATACTAGACGGTATGTCCAGTGTGT
AGGCGTTGCCGTGCCGTGCCAGCACAGTGGACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCACCCCGAAGTCGGAAACTGGATGTTTAGGCAGGTTTTG
AGTAGCTAACAAAACCAATGAACCTTCTTGAATTTATTTGTGTTGCCCCTGCCAACGTTGTCTGCGTTCAGCTTCTGTCGATCAACAGAAACTGCAATAG
CGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGCAAGAAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCCCGTTTCCAGCAGTAGGTTCGGCCTC
TGCGTTCGTCTTCGTGGTGTCTGTGCCCTGCACAGACGCGCGGTTCTCGGCTTTACTTCGTGTCGTTGCGGCTGACACTGTGCAAGTGTCAGCGGCAGTC
TTCGGCTGCTGCGTTGCAGTCGGAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATGGCATTCACGT
ACAACGGCGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGATTACTCCGCCATCGGCAGACACTCGCTCCAGTGTTGGAACGAGTGAGCGTAGCT
CTTAAGCACGTCAACGAGCACGCGGTTCACGCGTTCGGTCTGCCCGTCCGTCTGCGGATGGTCTGCAGTCGACATCGAAAGTTGCCTCCCAAGAAGTGTA
AACACTTCTTGCCAGAGATGCGCAGTGAAGCGCGGGTCTCGATCCGACACTATGTCGATCGGCATGCCATGGTGTTTGAACACCATGTCAACGAACAGAC
GCGCCGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAGATGGTACATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCTCCTGGCT
GTCCGGGGGAAGACCGAACACGAAGTCTAAAGACATGGACTGCCAACACTCCGACGGAGTCGGCAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGC
TTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATATATATTGGTGGGCCCAGTAGAAGTGTCGCGTGAGAAGAAGGTATGTCTTCT
CACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGATTCTCGTACATGATCCTGAGTCGCAGGTCATGGTCATTGGGCACGACAACGCGGTCCGCGTTGTC
GTCGACCGCACTGTAGAGTAGTAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGC
GCTGAGCTGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGG
CGTCAATGGCATTGACGTCGGCATCAGTCGTGACGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCG
GAAGTTATACTCCGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGTGACGCGTGGTCCGTATAGACC
ACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGAGTTCCTTGTCATGCACCGGGTAGTTCCGCTCAGCTG
GCTTCAGCTGACGCGATTGGTAGTAGACCACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACAC
AACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAA
ACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCTAAGCCAAGGAACT
GCCGCAGTTCCTTGACGTTCGACGGCGTTGGCCACTCATTGTTCACTCTGACCTCCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAG
CACGGGTATCTCACTCGCCTCGAAGATGCACTTCTTCAGGTTCGCGTAGAGCTTCTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGC
ATCTCAACATCACTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCA
CGCACCTGTTGAAGGTCGGAGGGGCGTTCTTCGGCCCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCATGCTCACAGCCGTGAGAGGGAT
ATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGATAATGCTCCTGGCTATCGAATCGATGATGACATCTTTTCGC
GGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAT
CACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTG
CCGCGTGACACAGTAGCACGAGGTCAATCTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCCACGTGCTCCCG
TAGAATCTCGTAGAAGGGACTCGACTTCAGCGAGTCCCAGCTCTGCTCCTCATAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTG
GTGCTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTTGGCGTCCGAGAGAATGCACATTTGCTCGATGCGTCCATCGTGCAAGT
CACGCGCGAAGCGCTTCCAGCTCATGGCTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGATTAGCGAGAGTCATCTCCCTGTACCGGGACCCGGA
GCAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCCCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCTCCAGTCCGAGAC
TTGCGCAGCGACCTTCGCATGCGCTGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTT
CTTGTATACCGCCGGCGGGTACGTCCCGCGGGCGAGCGACTTCAAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGGACGTTTGCAACCGTC
CGCACCGCTTGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTTCGTTACAAAGGGTGCGTCGACTCCC
GGAGTCGACGCGAAATTCCTTTTCGCAGCGCCGGTTCCAGGAACCGTCGCGACTTTAATACCTCGACGCTAACCATTGGCGGAGACCCCCATTACGGAGG
ATGCGTCGGCTCCCTGAGCCGACGAATCAAATTCACCCAATCCATCGACTCCCGGAGTCGACGGCGTTTCGTCACCTTGGCTCTTATTATTGGCCAAAAC
TGATCCAATCAGATTTGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGTCGGAGACTCTTCCTGCTTCGCTGAA
AAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAGCCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGCGTGCTCGCGCGCGCAAAG
GGCGCTCCGGGACAGCGGCATTAGGCGCTGACTCGAGTGGGGAGTCGCGCGCACCTGTCGGTGCGTTTTAGCGGCAACAGGGCCATCGCTCACTGTTCCG
CTGTCGCGACCGAAGCGTACGAGAGTGCGCTTCTCCCAATCGATGAATGGATCATGCCGTGCAAGCCACTGCATGCCCAATACAATGTCAAACTTATCGT
CCAGATCCAGAACGATAAAGGTCTCGACAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGTGCTTCTCGGTCTTCACGACGGCACCCGTTGC
CAGTCGTACCTCCAGCATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGTGCCCGAATCA
ACCAAAGCACGAAGAGAGTTGCTCTCTCTCTTCGAAGACACGTTCAAGATGACAAGGTTCGGTTTGTCATCATGCATTTTGCAGTGAGAAGGGTCCTCAC
TGGGGGGCTGCAGTCCTCAGTGTCGCATGTCCGAGTTGGACATGCGTGACTGCTTCACCAGTAGGGCGCCCCGCGCCTACTAGGTTCCAGCGTTTCTTTT
GTTTTTCCACGATGATGCCCGGCATCGCCGCGTCGACCACCGTCTCGGTGCACGGGTACCGTGCACTCTCGGGCATAGTGACCGATCCTTCCGCAACGGA
AGCATCGTACATTACTTCCTTGTTGCTGTTGATAACCAACAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGACCTCCCGCTATCGCGACCGGAGGCGG
TTGCAGCCTCGGCGCATTCGCATGCAGTTTAGCCTGCCTCAGACTAAACTCCTCCTGCATTGCAAGAGTAATCGCAGCTTCGAGAGTGCCTGGGTACTCA
CGGAAGAGATAGGTCTTTACAGGCCCATCTCTCAGACCCTTCATGAACGTGACGACCTTGGTCGCCTCTTCTATCGGGTTGGTCACAATGTTCGAGACCA
AGTACCGTGCTCTCTGCGCGTAAGCATGGACATCGTGCTTACCCTGCTGTAGGTCGAGGAACTCTGCCCTCGACCGAAACTCATTTTGCGGGGGCTCAAA
CGCTTGCCTGAGCTCCTCCTTGAAACCCTCGTACGTGCTGAAGCACGTAGGAGCAGAGAGTCGGCGTATATACGCCCAACTTCTCGCGCGTCCGCCAAGG
CATGACATGGCAAACGCAACCTTGGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCACCGGAGGAGAGGCTCGTCCT
CTCTTCCGACATAGTTGCTCACGTTTAGCTTCAATGATTGCTCGCGCGGTGTCGTCCCCGACGCCACCGTGATAGAGGAAGCAGCATCATGCTGCTCCTT
CATGATGAATTCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGTGTGCGCAGCATTGCAGCTACAGCCGCTTCTCCAATGACTGTTGACAGTCTTTGG
AGTGCCTCCCACTCTGGGTCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCGAAGTGGAGCTTTCCATGAGCACTTCCGCGCTCATGA
ATAGGTTCTCGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACCT
TGGCTCACTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAGTTAAGTATACTCGAGATCCACGAGTATACCTTA
AACAAGATAAAGACTCCAAGTAGCGGGTTTTGGTAAAGGATGAGAACTGCTATTTTTGTTTTATCTTCTGACTTCCTCTAAATGTAATATTCTAAACTAG
GAATCTGCCAACGGCTCGTTGGCAGGATTCTGCTAACATGCAAGTCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAGTAGGAATCCTAAATGTGTATG
GACCACCCGTCGTGGTGGTCGTAAATGTATGTAGTCATTGGTGTACCTTACACCAAGTCGAGGGAAGTG