Description :
From Genome Similarity Track
Location :
Scaffold_473:9946- 13045
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_473-fgenesh-gene-0.2P-type ATPase (P-ATPase) Superfamily

Sequence
3099 bases(100 bases per row)
GCCGTCCTTGCTGCTGCGTCTGGACAACGTCGTGATCGGCGTCGACGGGAAGAGCGAAAAGTCCGGCGCGTACACCCAGCCGTCTTCGTCGCATCCAGGG
GCGTCCAGGTTCAATTCCAACCCTGCGAGCGGGATCATCATCGCACTCAGCTTACCCGAACGATCGCTCCAACGGCTGCGGTCCGTTGGCAGCAAGTAGC
CAGGGTATGTGCTGCCAAAGCCGCAGAACGGTTGGTAGCGCTCGTTCTCAAAGATGACCGGGTCTTCCGACAGCAAAATCTGCTGACGGACGTGGACGTT
GATGCCCTTGCGACGCGACGAGCCGTTCTCGTTATGGCCGTTGGTCAGGATCCAATTCACAATGTGCGCAGGTTGGTCGAACGCAAAGCCGCGGTAGAGC
CCCTCGCGACCTGGAGTCGTGTAGCGGATCGGCACACGGTCCAGCACGCGTCGCTCTTGGTAGTCCATCATGTTGGCCAGCTCCGGGTTCAGGTAGTTGG
CAGCAGGAGGCTTGTATTGAACCAAGTCTTCGTATGATGACGATGCTTCAGCTCCTTCGGCCTCCGTGTCTCCTCCCTTGATCGCCTTTGACGACACGGT
CGTCTCTCTCACGAGATCGAGGTAGGCCGGGATAAAGCGGCGTCTGCAGGCTTCGTAGAAATAGTCTTTGAACAGGATCGCGACGATTGCGAAAAGCTGA
CCGAGCCAGAATCCGCTGCGCGCAAAGACCCACGGAAACGTGTACGTGTTGTAGTCCGGGGCGCTCCACTCAATGAGGTCGATCACGTACTGGAATCCAT
AGAGCGCCATGACCGTGAGCGTCATGCAGACCACTTCAAGCACGTCCCACGAGTTCACCATCAGACAGAATCGACCGCTCACGACGATGCACAGAACTGT
CCACGCCACACTCTCGAGCACCGTGTACTCGACGGATTCGCCATTGCGCATGATGTTGGAGACTGTGATGAGCGTGAAGAAGAAAACGCCGATCGAGTCT
ATGACGCCGAGAACGATCCATTTCCAGAACATCATATACGAGAAGAGCGAGTGTTTCCGCGTGGACGAGTGGTACAGCGCCGGGAACTTGAGCACGACCT
CTTTCGGGAGATCGCGGTCGAAGACCGAGTAGACCATGATCGGCAGCGCCGTGAAGATCAGGTTGTAGCCCTGCTGGATCAGCGCCGAGTAAATCATCGT
GCCCGAGTATGCACTCACATTGAGCGCATACCAGAACATCGAGACGTTGTACACGATGTTCTTGTAGAAAGTATACACCGTAAGTGCGGCGACTCGGTCG
TAATTCCATCGCCCATGGACGAGCAGCAGCGTGCTAAGGAAGCGGAATTGGCCGAGCGCGTAGTCAGAGCTGTTCACTGCCTGCATACCTTCTTGACCAC
TGATACCAATGCCGATGTGAGCACTTTGAATCATTGGGACGTCGTTCGCACCATCACCAATCGACAGAGTGTGCGAGTCGGGGACGTTCAGCTTCACGAG
CTCCACGAGCTGCGCCTTTTGCTGCGGCGAAACGCGACAGGCAACCACGACCTTGCAAAGCAGCGAGACGCGGAGCAAGTGGAGGTTGTAGAGGGGGTCT
TCAAGAATCATGTTCAAACAACCACCGTCAATCACAAGCGCGTGCTCGACAGGGTTCTTTCGAGGGGTTGGCAGATGCGTTGGCGTCGCAGATGTTCCGT
CCACAAAGTAGACGTCTTCGTCACGCGCGTCGTAGATCGAGTGAAAGACCTTGTCCAGCTGGCGCAGAATCGATCCTTTTGTGTGGTATGTCGCAGAGTT
GATCACGTGACGCTGCATGTCGTTGTTGAGCAGACGGCACGCGTAGCCAATGTTGATCGCAGTCTCCTCCATGTCGCCAGTGAGCACCCAGATACAGATC
CCAGCCTTTGCGAGCTGCTCCATCGCCTCGGGCACACCATCCTGCAAACGATCTTCAATCGCAGTCGCCCCCAGCAGCTCCAAGTCACTCTCGAGTTCGT
CCTGAAGCGCGTCGATTGCGTTCTTGTCACCACGCGCTTTCGCGTCCACTTCCTGCAGATCGGCACAGGCACGGCGGTAGCGGAAATGAAACTCCTCCCA
GTCCTTCACAGTCATCTTCTTGGAGCAAATCACGAGCGTGCGCAGACCGTCCTGCGCAAACGTCTCGAGGTTCTTCAAAGTAGTCTCGCGGGTCTTGGCA
TTTGTTGTCGAGATCGAGTCCGATGCAAGACGCGGGAACAGCATACTGTCTGCTCCCTTTGTGAGCACGAGCACTTCGTCTTCGTCGTCCTCCGTCATTT
CCATGAGCTCTTCGTCCGTCTTACGACGCTGCACAATGACCGACATGCGCTTGCGTGTCGAGTCGAACTCAAACACTTCGAGAATGTCGTACTGGTCGGT
GGTGCCAGCTGGGGTTTTCAGTGACACACTTCCAGGATCACGCGCAACGAACTCGTACCCAAAGTACTTGGCGCCGCACACGAGCGCCTGCTCGTCAGGG
GACGACGCCGAGTACTGGATCGGAAGCTCTTCCATCCCTTCCGGCACAGTATCGATGCGCTCGATCAAGACACCGTGACAGAGCGCCAAGTGCGTAAAGA
ACTCTCGAATCTTCGCACCCTGCTCGCTCGCCTCGTCGCGCATGTGCTTCCAGATGCGTCGGTCTTTAAAGTTCACATTTGGAGCCGGAATCTGCATGTA
CTCGTCCTCTTCCGTGCCGCTGCTGCTGCTGTTGGTATCGTCATCTGACTCGTCAATGTTCTTACTTCCTTGGAAATCGTCTCGAAGACGCGCCGCGAGA
CCAATTGCAGTGATACCTTTGCCGTAGCTCTCGCCGTTGATGCTGCACTTGCGGAACTCCATCTTGTTGCACGTCAGTGTACCCGTTTTGTCGGAAAAGA
TGTGCGAGATCTGGCCGAGCTGCTCGTTCAGCTGCATATTACGCGCGATCATCGGCGCGTCGTTCTCGGCATCATACATGTCCAGGTCGCGCTCCATGAA
ATACGCCTGCAGCGCCTTCACGAGCGTGATCGACACGTAGAGCGTGATCGGCACCATGGACGCGAGCGTCGTGAAAAAGTACACAAACGTGCCGATGAT