Description :
From Genome Similarity Track
Location :
Scaffold_12:99458- 103774
Transcript NameFunction/comments
Albla_Nc14016590ATPdependent RNA helicase putative
Albla_Nc14016600ATPdependent RNA helicase putative
Albla_Nc14016610conserved hypothetical protein

Sequence
4316 bases(100 bases per row)
AGAGGCAGGTGCCATTCTTTTTTGAATCCATTCTGGAAGCTTGCAGCGTATCTGAGGATTCTCGTATCGCCGGTCAAGAAGAACGATGCTTGAATAATCA
TTAATGTGGCGAATGGCTCGACCTGATTAGCAACAGTGTTACCAATCCATCAGGACTTAATCAGCTCCAACATACCAATTGACTGATTCACTGCTTTCAT
GCAAAGAGTTTCGTAATACCTCCTACCTTCACCGCTCTTTTTTGTGTCCAGATATGCCATTTTCTCCAACAGCTCAGGATCAGCTGCGCTCGGATATGGT
AGCCCGACCATTACAACACATCTACGCACATCAGCTTGTAAATTGGAAGCAGGGGTCAAACACATGCAAAAACTAACCTTGCTAATTCATCACTAAAGTT
TATACCTTCCGACATCTTTCCACCGACAACACTGAGTAAAATCGCTCCGGAATTGCAACTCAAGTGGTCCGAGTTTTTTTCACTCTTGCATGCGTCAGAA
TACTTCTTCAGAATTTTGTCCGATTCGTCTGAACGTTTTGGCTCCCGAAAAATCTGCTTCTGTTTTTCAAGATGTTGATACTGAGCTGTGTCGTTCCATC
GCTTCACAACTGTTTCTTCTAGCCTGTAGGAAGGGAAGAATACCACAATTCCACCGGGAACGATTCTCGAGAAATTAAGAAGAATGCGGCCTAGCTCGTC
GACTAATTCGAGCGAATTCCGCCTCGCAAAATTAAATTCCAAAGCTTGGCGTGTCGGGCCTGACGATAAAGTAAGCCCCACCAGGTTGGCCGGAGGAATC
ACATGGCCACAAGAGAAAAAATCGATTTTTTCGCGGGGAACTGAAGGTAGCAACTGGTCGAGAAGATGTTGAACCTACAATAGAATGGGTGTTAAATCTG
ATCGACTCTTTTTGCCACATTATCCATCACCGGTTGCATGGTTCCACCTGCGAATATAACTGCTCGGGCATCCTGGACTATATTTTCAAAGTGATGAGAA
GGATTCAGGAGCAAATACTGCAAGCTTGAAGTGTTCTTGGGTGCCTAGTTTACATTGCATGCACAAACACATCAGTGATTTCGCTGATTCGGAAGGATTG
AAAGCAAACAAACTTCATTTATTTTCACGAGAATCCTTCCATCGGTGCTCCTGTTGGTCAGCGCTTGCAAGAATGATTGAAGTGTTCTTAGAGGTGAGAT
GTGCTTGCTGATCAATACCACTCCTTCGGATTCAGTGGCATTGCCACCACTCAAAAGATCCTCGGTATTGGAAGGGAGCTGTTTCTCCATGAATCCAATC
AGCTTCTTTGGCAAGTCGCTTTGGTCGAGATAACGAATCAATTTGAATAAATTGAAATGATCCAGGTCTGCTTCGCACACAAAATCCCCAATGCGTAACA
TTTTGTGCATTACTTCACCTCGGCTTTCGAGCTGGTTCTCCGATTCTCTTTCCGTCATGATTTTCTGCGAGTACTTTGGCTCTGCTTTCATGACATTCTT
TATTTGACGCAAGAAATTCCCAAGCCTTTCTAGTATCGCGAGTAATTGCTTGATGTAAAAACAGTTTTGGCCTTTCAATCGATCTTCATATTTTTGTAGA
TATCTCCACAAACACCGACGAGTCTTGATAATTTCTGTACTATCAATATCGGCACGGTGAATATCCTGTACAGTTTCCAGGATATTGTGAGCCTCATCGA
ATATAATAATGCTGTCTTTTATATCAATCCCGAGCGATTCACGCGTCTGAGCACTCAGTATCATCGTATAAGGCAATGCCACCACTTGTGCCAGCTCAAG
ACTTTGACGGGTTCCATAGTAAGGACATACAGCGAGTTCATGTCCAAGTTTGTGTAAATCTTCGATATCATGGAGATGTGCCTAAACGAAATGGGTTAGC
ACAGGTCGTTTCCTTCAGAATCCTATTCACCAGTGCATAATTCTTGTACTCATCTAATAAGTCTTGATCGTAGAACGCACACGAACAGGATGAAGAGATT
GGTTCCATTTTCTTTTTTACGTGTCGAAGCAGATCTAGGCATCCTTCCATCATAGCAATGTCGGAATTCAGCTTGGATACTCGCGGATGGACGCACAAGA
GTTTACGAGAGCCCAATGTGATCGCCCGCACTTGCTTTCCAAACTTCGTTTTCTGCATTTCTCGAACAAATTGAGAAATCTGCGAATGTGTTCGACTGCA
GTAAAATATCTGTACACGCGTAGAGATTAACTTCAGACTTTTACAAAGTCACAAACAACTCAAACTACCTTCATGACTCCCTTGCATTTCTCCGTGCTTA
TGCTGATTGAACTCGTGATGTTGAATGGATGCGTTGAGCATTGGTCATTCCTTCGGCTTCCATCGCTGTCGTATGGGGACACCAGATCGTCATTTTCCCT
TTTAGTCCGACCCGGATTCCTCGTATCGCATTGCGTCTTTTCACCTCTTGCTCGTTTGACATGATCCTTATGTGATCCAAGCTGCTTATAAACTGAAAGT
TGACTAATTTTGCGTTTATTTTTCGCAACTGTTTCCTGACTTTGTTCGCGAATGTTCCGTAAAGGTTGTAGCGCAATATCAATCGCATCCTTATGCAATT
TGGTGTGATGCGAGACATCGCTGTGTTCGTGAGATGCCAACCAAGCTGGTTCTTGTGTCCCGGATAAACCAGTTTTCTCTTCTTTATCACAGCCGTCTCG
TTCTTTTAGTAAGCCGGTATTATCTGTATTTCTGAAAAGCCACGAAAGACTACCGCATATCAAGCTCATCGACTTGCCCTGATAACAAAAGCGTTTAGCA
AGACAATGATTCACCAACCAGGCGTGCTATACCGTTCCAGTAGGACTCTCAAATATGCCAATATGCTCATTCTCGATTGTTTGCCACAAACTGCGCATAA
AGTCTAATTGAATGCTGTATGGTTCATAGGGAAATGAGAAATATGAAGCAGAAAAATGGTTTGCCAATTCCTGTTCGTCACTGGCTGCGTCAGTCATTGT
GCACGCACTACCGTACTAAGTGGTAAAAAGGAGCCGTTACGAATCGTGATGGATCTTAAAAGGACACCTGCTTTCGGAGATAAGCAAACTAAGTCGTCTA
CTGCTTTTGCCACTCATAGATGACACCACTGGAGGTGACGGAGGAAAAGAACGAGCTTGTCGTTGATGTTCAGAATGTCATCTCTCGTATCCCCGATGAA
ATCATATCATTTCGGAATGAACTTGACAAACTTTTAACAAGATATACAAGGTCTCAGGAAAGTGAACAGGGTTTACTGAGGCGCGATGCTGAAATCAAAA
AGGAAATTGAAGTGATACATGAGTTCAGAACTCGGGAGCAGGAAGATGAGAATGATGCTATGGCTCAAAAAGTGAAATGTCGAGTGGAGCTGGATGTGAT
TTATTCGCAACTCGAGATTTCAACGCGTGCTGAGTGTGAGAAAGAAAAGGCTCTCAAGGATGAAAAACATGAGCTTGGCATTTTACAGGATGAGTTGCTC
GTCTTGAATCAGCAAGACACCGTACAAATCCCTCCGTCTGATGACGCCAATAGCTTGAAATCTGACGTAATGTCACGCATACTGAAGTTCAGAGTGGTAA
AATCAGAAATCGCTCAGGAAATAGAAACAAAGACAGTTCGGCTGCAAGAACTGAAAAAAGACACAGCTAACCTCACGATACTATTAGAGGAAGCTGAGGC
AAGGCATGAGCATTTAATAGAACTACGGGATCGCAAACAGGATTTGATTGCGGAGAAGAAACGGGATACAGAAAGCGGAACTCGTCGAAAAACTCGTCTT
GAGCGAGAGCTCCGCAAACTCAAATTGTACTTTGGAACCTTATCTGAAGAGATGCGCACGAAAGAAACACAGCTCAAAGACATAGAGAACCAACTGACAA
ATGACGATTCACATGCACGAGGCAGTAAAGATCAGCTGGACAGATATATCAAGCAAATAGACACCATCTACCGGACAACTCACACCTACACTGAAACCAC
TCAAGTACAATGGCAAAAAAATATTCAGTTGCAACATGAAAACCAGCAAATCGAGCATGATATTGTTCAGGAACGAGACAAGACCGAATCAATTTGCAAA
GATTCGATAAAGATTGAGAAGCTCATCCAAATCGCCAAAGAGCAGCTGCATGAAGTCGGCAGAAAAAACGCAGAATGCCAACGCGAACAGGAAACAAGTC
AAGCGGAGCTTGCGAATGTCTTGAACATAAGTGTAGAAAATGAGCAAAACAAGCGGAACCTATTGGAGAAGAAGGCTCAATATATCCAACGAGAGCAAGA
ATCTCTCAACAGAGTA