Description :
From Genome Similarity Track
Location :
Scaffold_61:99457- 121923
Transcript NameFunction/comments
g13909.t1RAW43636.1 hypothetical protein PC110_g138 [Phytophthora cactorum
g13910.t1hypothetical protein
g13911.t1hypothetical protein
g13912.t1hypothetical protein
g13913.t1RAW43643.1 hypothetical protein PC110_g134 [Phytophthora cactorum
g13914.t1RAW43640.1 hypothetical protein PC110_g133 [Phytophthora cactorum
g13915.t1hypothetical protein
g13916.t1hypothetical protein
g13917.t1hypothetical protein

Sequence
22466 bases(100 bases per row)
GCTTTCACGATCCGGATAAATGTTCTCTGGATTTTTACTCATCCTCTACTTTTATCCGGACAAAAGAGATCTTCAAACTGAGATCTTCACTTTCCAAGCA
GCCACGAACCCGTCAAGTCTCGCTGCCCCACCATCGCAATGTCGAACGAGCTCTTCCCATCAGCGCACTCCAATACTCCATGCTCCTCCGCGCCGCCTCC
GCCGCCACTTTTCCGGTCTACGGGGGACCTGGAGAAGTTGATTTCGCCGCATTTCGTGGCCCCGGAGGCGCGGCTGAAGCCCATTCCGACCAACGAGTGG
TGGGGCAACTTGCTGGCGTGGGACGGGAAGCGGGAGAGCGACGCCGTGTTCGCGGGGCCGTACACGTACAAGGTGGTGCAGGGCCAGGCTGGAACCATTG
GTAGCGGCCTCTCGGTCAGCTACTTGCTGCAGTACCGCACGGACGGCCCCATCAACGACAATGGAGCTCCTCGCTTCTACTTCTACCCGCCGACTATCAA
GAACTGGATCTTCTCTGCTGTGGAACTGGCGGAGCAATCGGGTACAGCCCCTCTTAGTATCCAAGATTGGGACGATATGGGGGTGCGTCTCGCCATGGCA
GGCATGAACATGTACTTGGCCTTGGGCACCGCCTTCACGACGGTGGAGTATCAGGACATGCAGGTGCAACTTGGCACCGATCATTGCATTGTCGCTATCG
ATGGAGCCCCGGCTAGAGAGGGGCACCAGGTGAACGGAATCAGTTTTGTAGTCTCACTGAATAACGGACAACAGTGGGTGCTCTACTTCTTTTCGAACGC
TGGGGGCAACACCTCGCTGGTGTTCAAGGACAACAAGCTCACGACTACGTCGAAGTTCACGGGAGTCGTGCAGGCGGCGTTTGTGTCGACAAGTGCCGTG
CAACCTGCGGTGCCGCAGGACGACCACAAGATCCTGCAACTTTACCATGCAAGTGCAGGGGTCTACCCGAGAGGAGTCTCCGTCCAGACGTTCGATTCTG
AGTCGTTTGCTTTCAACTGGCAACTTGTGAGAGCCGCAGGCAGCAACCCGGGTGCACGGTTCCTGCACTTTGCACTCACACACCTTCAGGCGATGCTGGA
TCCGTCTACTGCTGAAGCTAAGCACGAGCTTACACTGCACTCGCATACTCATGGACCCCTGTTTGCGTACGCGTTGGTATCTCCGCCAGATTCTAATCCA
ACGTGGCTGTGCCACGTGCTGCAGGCTGAAAGCAAGGGCATCGAGACGTGCACTGCATTTTACCCACCTCATGCCGGCTCGATCACGCGTGAGGTGGTGG
AGAAGCTGAACTTGTGCCGAGTCGTCACAGATGAAATTCATGGGGATTGGTCTTTGCCTCGTGAAGGCAGCTACTACTTCAAGGGCAAGGCGCTGCAGAA
GTTTGGCTCCATGTGTCTTGTTGCGCAGCAGCTTGCTGACACAACCAACCCAGAAATGAGGGAAGTGGCTCAACATGGCATTTCCAAGCTGCAGAAGTTG
TTGGCGGACTTTGTGAACAATCAATCAGCGTTCCCACTTGTCTACGACACAGTGTACAAGGGAATTATTTCCAGCGAAGCCATGGCTAAGAACGACATGA
ATGTCGATTTCGGCAACAGTGTGTACAACGATCACCACTATCACTACGGCTACATTGTGGCCGCGGCCGCCATGGCCCTCTACTTGGATGCGACGTGGCG
TCATTCAGCCGATGCTGTCAAGGTGCGCACATTCATTGACACGCTGATCCGGGACGTTGCTACCTCGTCGCCTGCCGGAAGTGACCCGTACTTCCCGCGC
TACCGCTACTTCAACTGGTGGCTAGGTCACTCGTACTCACACGGTGTGACTCCAATGGCCGATGGCAAGGACGAAGAGTCAACGTCGGAAGAGGTTAACA
TTCTCTACGGCATTGCACTGTACGGCCAAGTGACGGAGAATACCGAGCAGGAAGCGCTGGCAAAGCTGATACTGAAGGTCTATGTGCGTGCGGTGAACAC
ATACTTCTTGTTGCAAAATACTGGACCTAAAATCCATCCGGCGGGCTTTTCAAAGAACAAGGTGACGGGTGTTTTCTTCGATAACAAGTGCGACTACGCA
ACGTGGTTCAGCCCCAACAAGGAGTGCATTCACGGCATCCAAATGATTCCTGTTTCGCCGATTCTCGAAGTCTCTCGAGCACCGAGCTTCGTGCGCGAAG
AATGGGACGAAGTGCTCAGCAAACTGCCGATCGTACACGACTGGAAGGCGAATCAATCTGGCTGGACCTCGCTGCTATTTGCAAATTACAGCGTTCTTGA
TCGAACCAAGGCTTTGGAGGTGCTATCCCAGTGCCCGATGGACGATGGACTCAGCCGTGCTTGGGCCCTGTACTACGCAGCCACCCGGCCGTCACCCCCC
TGCTACTAGCAGGCTGCTAGTCGAACCTCGCACGCAGCTAACCCAGTCAAATAAGTCTCGTGTTTCGACCCCCCATTCCATTAGCCACAAATCGCATCTC
TATCTGTTCATCAAAACTGTTGCACCTCTTGTGGTTTGCCTCTATTCATCATGAAGAAGTCATCGCTTGTAGCAGGGATTGAGCCAAGTTGCTTACAGCA
GGCGACACTTGTCGGTCACGTAGCGAAATTAAACAACTGCAAGCCGTGAACGGGTTAGACGATGCAATAAATATGTAATCAGCTGAGCTCGTACCTGTCG
ATGAGACGTTGAAGCTCTGCTGGGGGCAGTGCTCCAATAAAGGCAGGTAGTTTTCCGACGAGGGCCCCCACCACCTTTAGTCCGCTCATTGCAACGGACT
CACTTTGGGTGACCTCAAGACGAGCTGCAGCTATCTCGAAACAGATGCGAACAAGCTGCAGATCGGCGTTGTTTTCCATGGAGAGCAATTCGCTGGCCTT
ATACAAAAATGCAAAGATGACCTGTAGCAGTAGACACCGCATGAATGAAGATCAGGCGAAAAAACTCAAATGACTTTGGGGGTAATACAGCCATACCTGC
AGCCCGCCAGCAACCACACCGTCTTCTGAGCAATGCTCGATAGCTAACGCTACGCGCGAAAAGAGTCTCTGTGCTTTCCAGCTAGCGAGCATATTGTTAT
CGGATCGGGAGATGGCACTACCAAAGCAAGCAATAAGTTAGTAGCCCACACGGATAAATCGATGATCATGAGACTGCAATTAAAGTGTACCTGAGTAGAA
CGTTACAGCAACAAACGCGGAGTTGGAGAGGTAGATCACCATGTCGAATTTCACTCCATACGCTAACGAAAAGCGTTTGCACGCGCGAGCCAAGCGTCTT
GTGGTCGTCGTCCGTAACGTGGGGTTCATCCTTCGTGCCCCCGAAAATCCAAACTACGAGAAGGTTCAAAAGTGACGAGCCATCCGCTGTAGGCAATTTC
GTACTGTCTTGCTCGCATTCATCTTCAGTAAGTCTGGTGAGAATTGACGCGATGCAATCAATGCACCCGCGCTGGAGATCAATGAGCAGTGATTCATCCA
TTGCGAAGCTTGAACCCGGAGCACACGGGATCCCCAGGATTTTGACCAGCACGACAAGTGCTTTCGAAGTGATATCTCCGTTATACATGTCCTCTGAAAA
CACCCGATTCAGGTAGTAGACCATTAGCTTGGCCGTCACTAGCCCACATACATCCGGAACGATTTCTTCACTAACGATCAGGGAACTATTTTGCTCGTGG
TGAGGTGTTGCCTCCCGCAGGAAAGCAATCAGATACGCGAACGCGAAGGGTAACACAAGAGGCGGAGGGAATTTAGCTAGTCCCTCCGTAGCGAGCATCT
TTACCTCCTTGAATTCCAGTGGATCCACAACGGAGAAGGCTAGGATGTGAAACAAACGTTCGTTTGTGACATCTCCATCGCTTTCTGGGGCTGTCGCTGG
ATCATTATATCGCTGATGGTCGATATACTCGTTCAGGTGGTCTAAATCTTCGCGCCCACACTGTATCACACAACCACATCAAGTTAATATCAACCTGGGA
AAACAGCGTACAGGAGAAGTTGCTCACCGCCAGCGTCGTAGCACAGTTATATCCAAATATCTGTCGCGGAAGCATACGTAGCACCAAAAACGGGGCCAAC
CGAGAAAACAATAGCCCCTCCGTAGCTTTAGCAGCCGAGGAGGATGTGTCGTCAAGTAGGTCTTCACTTAAACGCTGCAAATTCTGCAGCATCAAGTTTC
AAACACATCGATTAGAATTGGGTACAGCTATTTAGTGCTTGCGGCATCGCTCGAAGTTTACCATCATGTGAGCGGTAAGCTGCTTTCCCATCGTCTGAAA
TACAGCTTCGTCCACCCAACCACACGCCACAAATTGCCGTAGCATCCGGAAAAGTAGCGTATCACGAGGAGAGCCAAAGATTTTGCGAAGGAGAACGCTT
AAGACCTTGCAGCGGGCATTTGCGAACTGAACGTACTTGTTCCACCTGCGCAGCCACACATAGAGCAGCGGTATATTTTAAAAGAGGAACACGGCATCGG
ATCAATACAGCGATGCTCCTACGTACCCGTTTGGACCAAAGCACAGCAAGAGTAACTTTTCTTGTAGCTCTTCTAGCCCATTGTTATCTTTGGTGTTCCC
TTTTAGTAAGAAATCGTATTCGTTCCAATAACGGGGAGATCCAGGGGCTTCCGACGAGACCTTCGATGTCTGAAGGCCCCCAGACTGACAAGCATCAACG
AACCATGTCACCCTGGTTTCCAGCGAATATTGCGACGATGTCGCGAAAAAATACCCAAGCACCGATGTCACTATGAGGTTTTCAGTGTCGTGAACACCAG
CTGCACACAATCCCGCAATACATGACATAGGGTCCAGCGACGGTAAGCAAGAAAGTGCCTAGAGACAAGTAATATGTTAGTCTCCATTTTAAAGAGGAAC
ATGTGCACCACACGATGCAGATAGTCTTACCAATCGCCGAACATGATCATTTTCGTTGTCAATGAGACCTAACAGTACCGGTGTAAGCTGGCGCCTGTTC
ATACAGGAATACGGCGGTGAAATCTTCGTTAGCTTCATTATGAGCACAGGGACCATTAATGTTGTCAGCAAGACTCCTACCGCCAGTGTCGATAGAGCGG
CACTTGAGTGTCTGCACCGTCCAGTTGGTAAATGAATGTGCGCACGAGAGAAATGATTTTCTACACAACAGACAAAGTGCACAGCAAAGCAAACATATTG
TTAGCATTGCAAAAAATTGCATCAAAACATTTAGGGAACAACAATGTGCTCACCCGAATTCTTCGAATGTGAAAATCTTGCAGGTTCACTACGATCTCCG
TGATGAACAGTTCTCTCGATATGATGAAATCTGCCACAAACAACTCGAGTTCCGTTTGATCTTGTGATCCATTTGCAGTGAACTCTGAGTGAACAGGAAC
TGCCAATTCGTTGTCGCAAAGACGAAGTAACTGCGAAAGAAGCTCTTGTTCGTCGTCGTGCGTGGCTAAAAGACCGAATGCATCACTGGGCAAAAGTACA
CTTCGCAGAACTTTGAGGATGAAACAAACTGCTGCTTCATCACCTTTCTTGATTGCTGTAGCCATCCCTCTGACGAAAATGAAAACGAAGTACTGTTTCG
TTTCGGTTGATAAGCTCTTGAATGCTTGCGAGCATCCTTTGACACCACCAATAGAGTCCAGCAATATGCAGATGTAGCGAAGTTGGGCATACAGCACTTC
ACGATTGGTTGTGTCGCGATCAGTATTTGGTTTGATGTCCAAAACGCTCAAAATCCACCTCTTCAGAGCTCGAGATAGAACTTCGGACGGCTGATTGTTT
TGAATTTGAGACGATGCTTCACTACGCGTACACAGCAGTGAGGCGGTTGCCTCCCAGTGCCAGCACATCATATCCAGCACCACTACCTCATTTAAATCTG
ATCCAGTTGCGGCCTCCCCATGCTTGGATAATAAAAGCGCATCGCACGCTGTAGCGTACCATTGGAGGTGCTGGAGTGCATAGCTGAGGAACTCACGTCG
TGTTGAGTCTAGATGCCACTGCCGTAACACGGTTAGGAAAAACCGCACGCCTGTCACCATTTTGTGCATCAACTCCTTGCTGGCATAACTTCTCTTTGTT
GCTTCGTCCGACATCAAATAAATCGCAGCAATGTCTCCACACAGTAGCGCAAGTGCTTCCAGGGCAATCAACGCAAGTTTGGACAGCTTCACACGCTGCG
AATCAGCAACACGACGTACTCCTCGCTCAATAATACCACGCAGAGCATCCATGTACGCTTCAGCTCGATCACCCAGCAGAAACGGGCATTCGCTTCCAGA
AACAACAGTCATCATCTTCCGACGACGTCGTTGTAGCAACTCGAAAAGTGCAAGACAAGCAGCCAGCTGATTCTGCTTCTCGGCTATCGGCTGGATCCAA
TCCAACAGAAGCTCCCGCACAAAGTCATGACTCAAACTCGCAACGGCGCACTCACGATTCACCATCCAGTTCAGCAAAACATGCAGTTTTTCCGCCTGCG
GGCCCCAAATGCAGCAGTTGGTACGAGACGCCGTGCAATCTCGCGTCGCCTGCATAATTGCGGCTGCAGCTACAGCACACACCAAGTTTCGGTTCTGCGC
AGTTGTCCCAACCTCATTTCCAACTTCATAAGCGTCCGCAACCGTCGACTGCAATGTACCACCAACCAACAATGAGTCAATTTCTACCATTTACAGCTTC
TCACAACAGTTAAAACGCACCAAAGCAGCTTGCAACCGTGCAATCCGCTTGTGGTCCGACAGCGACAGCACTCGACCCTGCACAGTCAATTTCTCCAATG
AGTGAGGCCACCCGCACCACTATCAGCACTACAGTGCATTGTTCAGCCCTAATTGACACCTCTCCAGTGCGTTCCAGCACGTCAACGTCGTCACTGCCAC
TGGGTTTGAGTAAGGACTCAGATCTGATTCCATTCTTCACCCGGTCCAGACTTGTGATTGCCGCCTCCATCTACGCATCCACAAGGATTAACTTGCACGA
TTATAATAGATAAAGGGGAGAGTATAAATTTACTGTAGACATACGTGGAAGAGCTCACAGTCCTGTAGCACTCGCAGCAGCCGCCCCGCGCTGTCGCGAT
CGCGAGTTCCGGCCGCCATTTTTTTCGTCTTGTCAATTCAGTCACGGTACACTAATCCAGTGTGGTGCACAAAGATATACATATGGCTACAGCTGTGAAG
AAGGGACGGCTACAGTTGAAGCAGCAATGGATACAGTTGAAAGACACTGGTTGAGCCATTAGCACATGCATTTTCTCATTCGATCGAGATGGTACCAACT
CCATTTATACATACAGAGCTAGAGCTGGTGGCTTCCTATCACTCGGAAGGTCGTGGTCCTGTCCTGTCGACTGAGGCTTTACAGCGTCAGGGTGTTGGGG
TCGTCTTGGCGGACTTTGTCCACGTCATAGTACGTCGCACTGTCGTCGGAGTGAGCGCTCAGGAACGACTGGTTCGAGGACTGGTTCGAGGAAGCTGATC
TCCTGCGGTGCGACGGGTAGTACATGCCGTCGTTCGTGCTGGTGGTGCTCACTTGGCTCTGGGCGTTGAAGTCCACGCGAGATGTAGCGAAGTTGACCCT
CGACTGGTAGCCATACGAATCCACCGAGTCGCGCATCGAGAACGCAGACGAGGTCACACCGAGAGGACCGATCTCGTAGCTCTGGCCTTCTACGTCGTTG
GTTTCACTTCCTTCCTCCTCAACGCTAACCACGGTCTTAGATCGACTCTTGAACCAGCCGCTGCTGTCACCATCAAAGCTGTTGTCAGAGTCGTTCGAGA
AGATCGACATCTTGGCCTGAGGACTGCTACCGTAGCCTTTGCTTTTGCTTTGGTTGCTAGGAGCAGCAGCACCCATTGCGGCGGAGAACGTATTGTCTTG
CTTCACAGCCTGTGTCACGTCCGGACTGGTAGCAGCAGATGACACAACCGAGTCCGAGAAGTTCACGTAGGACTGCTCCATAGGAGCATACGAACTGGCC
GAGGAAGCTGCCGGGGTAAAGCGCTGACCCATAGTCGATGCTCCAGGAGCAAACTGCCGGCGTGCCATTGAGGGTGCTGGCTGCGCGGCTACGACGTCTC
CGTCAACATCCACGTCGTCGATATCCACATCCTTGTGCAGATCGTCCAAATTGAAGCTGTGCTTCCTTCGCGAAGACGAACTACTGATACCAGAGTCCGT
AGCGGAGAAAGTGCTGACATAAGCGTCGAGGGGCACAGTCGATGGACGTGAGCCGAGACCAGAACCTGACATCCCCGTTGCGATCGAAGCACCTCCTCTT
GAAGACTGGCCTCGCGATGACGGCGGGCCTCTCGATGACGATAGACCTCCGGCCACGTGTTGGCCCCTCGACGAGTTCTGGCCCCTCGACGAGTTCTGTC
CTCGTGACGAGTTCTGTCCTCTTGAAGACTGTCCTCTCGACGATTTAGGTGACGTTGAGTGTCCCGCTTCATCGTCCGTATTCTTCGTACCAAGGTACGC
TGACAGCACATCGTACGTCGGAATTGGTGCCTCGGGGATGGGAGCAGCAGCAGGGGCAAGCGCTGCATTGCTGACCGCAAAATCATCAGCGCTTTGCGTC
GAGTCTCCAAACGAGTACTGTTGGTTACGAGAAACGGGTGGGCGAATCTTGCCTTTAGAGCGACTGAAAACCGGAGCAGGCTCCGGGGCCGGCTCCAGCA
TAGGCACGTGCTCTGAATGACCACTGCGAGAACTCTGTGTAGTACTGTAGCCAGACATCGCGCTCGTCTGAGACTGGTACTGTTGCGGTTGATACTGTGG
TTGCTGGTCAAGCTGTTGCTGCTGCTGTTGTTGCTTATTCTCATACCAGTCCACGCCGCGGCCTGCTGGGGTAGTCTCAACTTGCTCGTAGTTGCGAGCG
TTGGTGGACGTGTGGTTGCCGAACTCGAGGTTGATGTCGGTGGCGTCCAGGCTGGAATTTTCCTTGCCATCCTTCTTGTGACGACAAGCAACGATCATCT
TGTGGATGATCGTGTACGCTTGACGCACGAATAATAGGAGGAAGATGAACATGTTCACACCGATGATGCCGTACGCCACATTGTCGCGCACAGTCTGCGG
GAAGTAGTCATCTCTTGCCACGATGAGCATGAGGCAAATGAGAACGACCTTCATGAACACGGACGTAATGCCGATGTAGTACAAGAACCGCAGCAAGTTC
GGCTGACGAATTAGCAGCAGGATCAGGTACACCATTGTGATTGCCAGGATGCACAACAGTTGGGTCGTGGCATCCCGAACAACGCCGACGATGGCGCCGG
TGAGCACTGCCAGCAGAATACGGGGGATGAAGAAGAAGCGGTTGTCGAAGTTGTACTCGTCGTAGTAGACGCTGTACTTGCTGCTGAACGCTCGCTGGTC
ATGCTCGTACGTTCCGACGTCCTTGAGCTCGTCGGTGTTGTTGCCAACGACGATAATACCAAGTCCAAGAGCGCACAGCACAACAGCGACAAGTGCAACG
ATGCCGAGTGCGAAGCGCGAGCTAGAACCGCTTGCTGAGTCGTTCGACGACCCCTCCGAGATGAAATAGCTTCCTGCCATGGCAAACATGTACTGCGCTA
GCAGCAGCGCCAGCACGCCGGCCCAAACGACCTTCCGATACCACTTGCGCGCCACGTCACCGAACGATTCGTTCTTGGCCAAGGCGCCCGTTATCAGTAC
GATCACCAGGTACAGAGCGTGCATCGCCGCGACTACGATGACAAACGTCACGAGCGTGTAGAAGAAGAGGTCGTCTGCGTCCACGCCGATGAGAGCCGAA
TATCTCGCCGGGCCTGACTCTCCAGCAGCCGCGACGATGCCCGTCGAGCCTGAACCTGAGTCCGCGAGTCTTCTTGTGCCATTGGTACTGCTGCTGGAGT
CGTCACTGCTCCCCTTAATCAGGTTAAAGTTGGTCCACGAGAGTTCCTTGGAGAACTGCAACAAGAATGTCGGCGCTCCCTCGATCCGGAGCTGGCTGAT
CATGCCTGCGAACTGTGCCTGCTCCACGATGTGCGTCATCTCGTAGAAGCCTCCAGAGAAGCTCAGCGCCGCTGCAGCACTGGGCATTATCGAAGCCCAG
AGCATCGAGCCCGTGCCAATCACAGCGGCGCCCGCCAGCGAAGTAGCAATGACGCCCGAGGCCGTGGTGCCGGCCTGCGAGTCCAGGAAGTGCCGCGTGC
CCGTGGAGTTGGTGGGCCACTGCGTGTTACTGCCGAAAACACATCCGGAGCACGAGTTGGCCTCGACGTAGCTGGCGTTCAGGGCGCCGAGGTCCACGTC
CGAGGCGAGGTGGAGCGCCTGGCGGATCTGCTCCTCGCCCCACGGGATGGCGTACGTGTAGAAGAGCAGGCCGAGCGCGGCCAGGAAGGCGAGTGGCAGC
AGCAGCGCGCAGAGCTGCGAGATCGCCATGCAGCCGCAGCATTTGGCGGCGCAGCACAACAGCCCCATGACTACCGGTAGCTTCGGGGTGGCGGGTGGAT
TACCAGTATACGAGGGCGGCGCTCGTGGTGGTGGACCTGCTGAAGCGGAACTGGCTGCCGTTGATGCGCTTGCCTCGGTGGATGCAGAGGCGAGGGGAAG
AGCCTGTAAGAGACTCGCCCAATGCACAAAAGTCGGATGGGACGCGAGGTTAGAGACCCGTGTCAAAGTGCAAGTGTTCAGCTCGAACAGCTCAATCAGC
TCTCTTCAATATTGACCAATGGAAGCACGCGAAAACGATTCAGACCGTTTCGGTGAGTGCACTTTCGACCAATGGGAGTATGAGACAGGGGTTGTCAAAA
CAACCGTACATGGAGGCTTCTAGCACGTGCATGGCACGACATTTGTTGGCGCGAAGAAGGCTTCCACTGCATGTACTACATGTAACAGAATCCTTCTTCG
TCCTTTGGACAGTGTGTTGAGCGTGCTGTTGCAGGCTCTGATAATCGAAAAGCACGATCGTTTGACGTACGTGATAGGATACATATACGGTAGCTTTCTG
TGCGGACTTTTACTCGAAACCACTTCTCTTCTACCGAGAGCGGAGTTTGCTTTGTGTTGGTGAGTCTCCTTTGCGTAGCTTTCCTGGGCGATGTGGGGGT
GAAGAATACATGTACGAAGCACGCTGACGGCGAGAAAAAATATACCGCGCTTCGACAACGTCATGTCATGCGGCGACGATGCTTTGACTTTGATTGGTAC
CTATGTGGTTTACACAATGCGATGTTCTAAATGTACGTTTATCCATCAAACCCGTTTCTAAACTCATTCGATCGTTTCTAAAATAGACTATGGCCAGCGC
GACGCACCCGTTTGAATGGTACGGCCGTGCACCGACGCCCCTAGCGCTCGCTCCGTGCCGCCTTCTCCCGCTTATCAAAGTTGACATTGCTCTACCCGTT
CTCTTCTTCCCAGCGAAGTCAGCCTCTCGTTCCCCGCGGCTGTGGACGCGCAGTACGTGTTGCAGACGCTCGAGGTCGACGATGAGCTGCAGCCCGACAA
AATCCACCGCACACTGACCGTCAAGGGCACAGAGCTCCACGTGTACGTATGAGGCTATTGATTCCGTCTTTGTCTGAGGTTACTTTGTGGTCTATTGGTG
CTGACTTGTTTGTTGTTTGTTGTTTGTTGTGCGGCCGTTTGGTTGGTGGTGGTGCGCTGCAGCCACTTCGAGGCCACGGAAATCCGACTGCTGCGCGCCG
CCGTGTCTTCGTTCTACGACATGGGCGTGCTTGCCGCACGCACGCTGCTGGAGTTTAAGGAGTAACCGAGGCAAGAGGAATAAAGTACTGCGTCTGGGTT
GACCAAATCCGTTTCGGCCCATTGGGAACTGCCTCCATCATGCCCGATCCACGCATCAAGTGCTGACAGGCGTCACTGCTTGACCATGGCAGCAACGAGT
TAACCTCATTTTCCGCTAGCAACGACTTGGCGCGTTAATTTAACTGCTGGTGAGGCATCTTCAAACGGCAGGCCAGGAGTCTGGTTCGTTTCGACAGACG
GTTTGGTTCGCAGCAACACCCCTGAGTATCTGGTAGAAGCTTCCAGCAAGTGGAAGCGCCTCTCTAGTGTGGCCACGCGAATTCACTCAACCGTGCGATA
ATGCATCGTATCACTGCGAGCAATTGCTATCTGGAGCAGCGGTTGGACATTCCATTCTGCTAGTCGCGGGAGCTCGAAGACACAGAATCAAAATGTCAAG
TGTAGCAGCTCGTGAAAGTGGTTCTGGTGACGAGCATAGCGTATCAAGCGTATCAAGCGGGGGTCAATTGCTGCGGGATGGAGTCCATCTGATGGACCGT
TGTCCACTACAACACAGTGCTGGCACCTGCGACAGATGCAAGCAGAGAGGATGGATTTTACTTGTAGAGCAGGAGAGGATGGCTTGAGGTTTGCTTGCTT
TTGGGATGCGAGCCGACACCGATTGCTCTTCGCCGTGTAGTGTGGGTCTCTGTACTTGATCACTGCTGTCCCACGCCGAGACTACTGTATAGGGGGCGGA
CAAATCCAAAGGCTCGCCCCAAACGCTGCTTTGAAGCACAGCGGCGGTCAACTTCCCGACATGAAAGGACGACCGCAACTTTGCTGAGGAAAGCATGGTG
GGGGCTAGTGCTCCAACGCGATGACTTCCGTTGATTCCGTTGGTCTCGAGGCTCGGTGACGTTAAGCGCGTAGTGAGCGCTGGTTTCGCGGTTTTTAGCC
GGTTTCCGGTCTCGTAACGGGGCCAACAACTCCATGCAGCATTTACGCTTCATTTCTCCGGACGCAGAACTATTCCTTCCGGTTGCTCTGGCCTCACAGC
CAAGTGAACCCCATGGGAAGCACCACACAGCTCCATCTCACAACTCAGGTATGGGTGCAGTTGAGACGGAGATTGCCAACTTGGAAGCGATCGCCGTTAC
CAGGGGAAAGCAAAAGCAGTCGGCAACGCAGACAAATGTCCTCGTGGTAGGAAGGGGGGAGGCTGCGTGGCAATCGTCCTCGGCCGCTGCCGCTGGGTGT
CGTGCACATGCGGACGGGGCTGGAGACGATTATCATCTTTAACCCTTTCACTCGCAGCGCGCCACGTTGTTCACTGAACCTTACGAGATTCGCAAGGTGT
ATGTACATACAACGCTGGGTGTCTGGATCCCAGCGGTGGTTGGAATGTGACCTGCCACATGGGACTTCCCGAAACAACCGAAGCCATCGCTAATACCTGT
ACCCAACAGGCGCCCGCAGCAAAACCATGTCGAGACGACCAAGCAGCTGCCGTTTTTCTGAAGCCGTTGTGTGTAACGTGCAAGTTGTCGGCAACTTGTG
TCACCGAGACACGGGCATAGCCAGCCGTCGATGTCCAGCAGGCGGGTTTCTGGGCTGTGCCCAACGTCCCTCTCCTGCTTATCCTAGCGAGTTGAGGTCA
GCGTGGCGGCAGTCTTTCATCACTCGCCAATCCGCCCGCTTCCAGAGATTCACCGTCCACCTCGGGCTGAAGCATGCCGTCCCTCTTCGTTGACGAGCTG
GCTGTTGACACCCGAGAGCTCGTGGAGCGGCACGTGGCCGAGTCGTTCGCGAGCCACCGCCCCGTGTCCTTCGACGACGCGTTGTCCCGCTCGCATCACA
CGTTGCGCGGTCGCAACTCCATGCCGGCAGTGCTGCGACTGTCGTCGGACTTGGGCTCCAGCCGCCTCTCGAGCTTCGGCAACATCCCCGGCCACGAGGT
CATCGAGACGTCGGTCCGCTTCGTGGGCGTCACCCGAGTGTCCACCCATTGCGAGTTCCGGCTACACGTGGACACTGGCAAGGAGAACTTCGTGCTGCAG
AAGCGCTACTCGCAGTTCCGCGACCTGCGCCAGCAGTTGCTGCTGGACGGCAAGTCTGCTGCAGCGGGTGAGAAGGGACGCAGCGGCCAGTGCCGCAGTG
GAGCGTGTCTGCAGCTCGCGCAGCAACTCGCCTTGCTCAAGTTTCCTCGACGCAAGATGAAGTTCAAGCTGCACCGGGACGACGACGTCCGCATTGCAAG
AGAACGCCAGGCTCAACTGCAAAACTTCGTCGAGATGGTGCTGGCAGTGTACCGCATGGCGCCCAAGCGGCAGGTGCGTTGCTGCGTCAACTCGCAGTGT
CGAGTGCTCAAGGCTATTCGATCCTTTCTAGACATTAAGGATTTGGGCGAGGACCTGGTTCCGGACTGGAAGTCGGTCAGCAATGGCAGTAGCACCGGTG
GTGACGTGCCGATTCTGGACACGCCGCCGTCGACAGGGGGGACCAACCCGTCACCAGTTAGCACGTCGTCCAGCGATGCTGCTGGCTCAAACGGCTCGCC
GATCCCCGCGAGGACGTCGGCCATGTGCTTGGAGGAACTGTACACGATCACAGAAGACACCGAGCACGCCTTCGTCTAGACGATGTAGCACGACATAAGG
ACGGATGCAGTCCTAGCGTCGTGGACGCGACAACCAACCAACTCACCAGTCGCCATCTGTAGTAACTTATTTGCTTCGTTTGTAGCACCCGCTCCATCGG
TAATTCAAGAAGATGTAGCAATGGAATCCCATTAATTTACCTTTGCACGTGAACACCTTTGTTCGAGTTTAGTGTTCCACACCTTTAGCCTTGAGCAATT
CTACGATCACTGTTGAGACTTTGTCCTCGTCGTTGCTCAGCCCGCCCATGATCTGCGAGGTCTTGCCCCACTGGACGTTGCTCACGAGAGCCTACAACCA
GCAACAGCAGGTGTGTCCGTTAGCTCAGTTGTGCTTCCTGTATCCGTTAATCGAAAGCGTCCAACCAGTTGATCAGTTACCTGCTCATGTTTGTTGTCAG
TGGTGCCCCGGCCACTCAGACTCGTGTTGTCGCTGTCCCCGGCGCGCTGTCGCGCCCACTTCATCAAGTTGTGATTTCATGGACATACCAGCACCCGATA
ATGTAAGACATGCCAAACTCCTCATCTGAAAAGCATGAAGTACGTACGCTTCGCCAGCTACTATCGTTTCCACGCGAACGACGCGGAGAGGGTTTTGGTT
TGTCGATTATTGGCTTTTGCGCTCGTCGTAGTTGGCCACAGGAGACGCCCGGAACGCCTCGCTCGGTTTGAGCTCCTCTGCCAGACGTCGGTGATAATGG
CAGCTTTGGCAGACAGAAGTTCGGCTCGCGTACTGATCGATAGCAACCAAGATCTGGTCGTGGTCCCATGGTTGGAATGTGCTCTTCCTCGTGTCTAGTG
AGAACAGTGTCCACCAACTCTTGTTTGTACTGGTTCCACCTCGCCTCCCTCCGCAAGTCTCGCGTGACGCTGGAAGTATCAGCACGCGCTGAAAGACCAA
TGACTTCCTGGCGCAGCATTTGCTCGGTGGTCGCGTCCTTCAGCACAATTTGTCGGAAATCCACGCGGTCGACACGATACAAAGTGGCCGTCGGTGAGGA
AACCAAGACCGAAAACACCGCGTTCGTCACACCAAGGGTAGCCTCGTAAAAGCCAAAGTAGTGCTGACTTCACAAAACGCAGTGCGAGGGTCAGTATGTT
AGATAAGCTTCGCGTCGAGAAGCGGTATTACTACCTGCAGACGGTCGATATTTCAACAATGCATGGCTGCTTGCGGCTGTCGTGCTTCTTCTGGTCGAAG
GCCGAGTAGCGTTTGACCAGCCTGCACTCACCATGCTTGATGAAATAGAAGTTATCTTCGGACGAGAACCAGCGGAGTTCAGATCAAAGGCAACAACAGA
AATGAGCATCACGTTTACTTACTTGCAGGTTCGCCTTCCACAACAATGACATCGTTGTATGTGTGCTGTATCTTCTCCATTCGGTCACACAGCTTCAAGA
TGCCTTCGTCTTCCCAATGATCCAGGCAGGCCACACCTGCTAAGAATGTCATTTTCTCGCTGGCAGCAAAGACGACAATTTTGCAAGTTAGCTAGTCCAC
GTGATTGAAAGTTGCGTAAAAGCTCGTACCGGAGGTCACGCGACAGATTGCACGCGCGTAGTGCCATGAACGTGTCACGATCAATCTGCATGAGCAATGT
GGTTTCCGTGGCCACAACCGAAGCGGTACGCTGTTGCTCTTCAAGGAGCAGGCCAACGTCGCCGAAGACTTCCAGGGGCTTCATCGTGCGCACAATGTAC
GTAGCATCATGTGATCGATCGATCTTTCCGCCTGGGTTCAGGAAGCTGGAGTGCACGCGGGCTCGATTCATGATCTCCTCGAACTCGTTCAGCGTTGGGG
CTGCCATTCGCGAAAAGTCCATGACGACGCTCATCGTTCCATACATGATGCAGTAGAACGCATCTGCACGATCACCGATTCTGAAAAGCGCATCTCCGTC
CTCAAGCTCGATGCCTTTGGCGGCCTTCAAGAACCGTAGTCGGTCTCTCGGTGGCTGCTCGCGAAAGTACTTGACGCGTTGAACTGTACAGCACAACAGC
ACAAAGTCAATGCAAATAATGACAAGACGTCGGCCGTGAAATTATCTGTAGATACACCGCTTGTAACATACTGTATTGATCGAGGAACTCGTAGTCGGCC
TTGCATCTCGCCACTTCGGACAGCAGAAGAATTCGCCTCAAGTTGGCTCGCACCTCCGGAAGTTCGTGGTTTAGCTGCTCCTGCCAGCTCGCCCTCTTCG
ACAACCTAGCAATGGTCACATCGTGTCACAACATACTACCAATATATGGTACTATCGGCTCTCTGAATGCCAGGCATACGCACATGCTGCGCGGCTTGGC
GAGTGGACGACCAAGATGTTGAAGGTAGTAGCCATTTAAAATTATAAATGGCTACATGTACCTAATATAGGCGTCCTATGCTAGGTTGTCTTATGTCATC
CACACTACTTCTGAATCTCTTTTTGTCGACCACTTCACTCCCACACAAAGTCGAAAGGTGAGCACGACGTCACATGGACGCATCTGCTGCCTGTTCACGC
TTGCGGATGCGCTCCCCCAGCGCCGTATCGCGCGATACAACAACTTCACCACGTATTTATCCCTCTCACATACCTGCTGGTGTCATTTTCACGCAGATTC
TCGCCGTCTATCGCTATTAAACTCCCGCCTAACGAACACCATGGACCCCGAGACCAAGAAAAAGTGTTTGGACGTCGTGGAGCACTTTATCAAGCTCGAT
AGCTGCGGTGTGTTGCCATTTCTATTGAATTAGGCTTTTCCGGACTGGTAGCAATAGACTCACGCTTGTTTCTGTGGCTCCAGAGCCCTTCCGCGAGCGT
GTCAACTGGGAGGAATGGGGTCTGTACGACTACCTGCAAGTGGTCAAGGAGCCCATGGACCTGAGTACCATCCGCAGCAAACTGAGCAAGAACGAGTACA
AGAAACCGGCCGAGTTTGCGCGCGATATGCGCCTCGTCTGGCACAACTGCAAGCTCTACAACCAGGACGGCTCGGACCTCTATCTGCTGGCCGATGAACT
GACCAAAAAGTTCGAGGACCGGGTCAAGACCATGAAGCTGGACGTGGGACCGGTCCCCAAAGCGGACAAGAGCATCCCGTACGGTACATTGATGTAGCTT
TGATGTTTTAGTTGGTGAGTTTTAACGTGGTATGTGCTGTTGAGTAGAGCCCCGAGTCTGGAGGAAAAGATTCACTTCAGCCAGAACATCTACAAGATCC
CGAGCAAGGATTTGAATGCAATTATCGAGCTGCTGCAGGAGCAATGCCCCAAGGCGCTGGACAAGAGCTCGCCCGATGAGCTGGACATTGTCGTCGACCA
CATCGACAACAAGACGTTCCGCGACTTGGAGAAGTTCGTTCTGGAGAAGGTTCCTGAGGGCAGTCGCGAGCCGATCTCCACGCCCAAGTCGTCGAAGAAG
TCTCGACGGCCACCGAGCAAGAAGACGAAAACCGATCCGTGATCGAAGATGAATGCGTTTTGAGCGTGCCTAATTTGCCTTGACTTGTGTTTCATGCTAT
GCCACAGCCTTTCTGGATAAAGAGAGAAATGGCGCGTGTATTTAACCTCATCCAGGCACGCAGTGAAAATCGACCGTCTACTTGGACGGTATGACGGCTT
ATCAGGGTATTTAGTCATCTTTTAATCCCTTTACGCTTCTTCCCTGAGTATTGCTGCTCTCATTGCGTTATCTACTTCTTCTTTCGAAGCATAGTTGCAA
GCCGTGTTTGCCGTTGGAATGTGGCCTCGAAGCTCTTTCTCTTCTGCTTTTGTACGGGCTCGTCAGGCTCGTGTCGAACTACGGCAGCTGCTGGTCTACC
GCCGAGCCTGGTGAAGTCTAGTGGTGGCACAACGATATTCTGCGCTGGTGATGCTTCATCAGAGTCATCTCTTGGCAACCCAAGCTGGACGGGAATTGCT
GCTGAAAGGCGAGCCCCTGCCTTGGCTCGAGTGGATTGCCACTGAGGTGGTATGAACTTAGGTCCATCAGGCTTCAGTGTTGCCCCAGTGCCGTGTGAGG
CACTTGGGAGTGGAGCCACTGGCTGCAGTTTCGGCAGCGGGAGTTGAAACTTTGACGGACGGCGCATCGTTTTCCTCTCGTTCGTCGTGAAATCCCGCGC
TGTGTGTTGACGACTCGATTCGGGCTGGTATTGGGACGAGCGTTTGTACTCGAGCAGTTCCTCCTTGTGGAGCTCCATCAGCTCTCTAACCACCAGTTGA
GAAGGTTGTGAAAGGTAATATCGCGATCTTAAGAGTACGCGACGACCAGGGAAATGCATATTACCTGAGTGAAGGCTCATTGCTGTTGGCGGTGTTCCAG
TTGGTGCCGTGAATCTTCTTGCCGGCTTTCATGAGCCTGGTCCATTCCTGCACAGCAAAAAGGTCATGACGCTGGACGATGGAGGCCAAAAGCATGCTCA
GCCTTACCTCCTCGTCGTGCCGACTGGTTTCCACTCTGGACGTCACGATTTCTTCGAGTTCGTCATGATATCGCAACTGATCCTCTCGAGCAGCGAGCTG
CTCTTTAAGCTTGCCGATATATCGTCGAAGATCCTCCTTACGTCTGCCAAGCTGCTCAAGCACGCCTCTGCTGGACTGTTGAAGTTGCAGTGGCGGGTGA
TATTCTACATGGAGTTCACGGCAACACTCTCCTGTTACATGGAGCGAGGTGGTACAAAGTGTTCATTTCTGCGTACGCGTTCGTCGCTTGCGTTTTTGCA
TCTGCTGCTGGAACAAGCCCAGGACGAGCAACAGTAGCAGCACGCAGCCGATGATCAAGCCAGGCGTATCGATCTTCGAGCCTGATGTGCCTCGAATTTG
CGGCATTTCGCTACTTCAGCGCAGCAAGGACATTGACAATGTGTCCTGCATGATCAAGCCGTATTTTTAGGCAAACCTCCGCGATTTCTTATGACACGAA
GTGCATTTATTTCGACTGGGGCTGAATTGGCGTCCTAAACTGTACAATAAGATAAATAGGAGCACGCAACGCAGCTCACACGTCCGCGACGAACACGTCT
TCATCCACAACGAAGGCCGACGCGTCGAAGCTCGGAGCCGGCTGGTCAGATGACGTCGGTGTGAGCCAGTAGTCACTGAAGTCCAGGTTGTCCCAAGTTT
CTCCCACGTCCACGGGGGATGTCTTGCCCTCTGGCAACGCGGCCAGCGCCTCAAGTCCCGTGACATCGAGGCATTTACTAGCGTCTCCCTGTCCGTCCTG
AAGGATGCGATCCAGCACCTCCTCGTCCACAGCATCAGGCAGTCGCTGCAGCTCCAACAGCTGTGCGTCCTTGGCCTGGAATCCGTCGAAATGGCCGCCG
TCCAGCAGACCTAGATCCTGCAAGAACCAGCCGGTGGGCCCTGAGCTTGCACTGGAGGCCTGCTCGGCCTGCTGCCTGGCACGTGCCTCCTCCTTCATGG
CCAAGTGGGCGCTGAGCGGGGCGCGTCGCGCGCGCTGACGCGTCTTCTTGCGCAGACGCTTGCCGGCAGGCTCATGGTCCGCGGAGGCCTGCGCTCTGGT
CTTGCGCTTGAGCTCGAGGCGGCGCTGGTTCTTGTTGGCCTTCTGCCGGTGCAGGTCGCATAGGTTGTGGCGCTCGCCGTTGCGCTTGAGCGCGCGCGGG
TTCCAGCACTTCTTGCTCGGGTAGCGGCACATGACCTCGGCGTCGTGCGCGGGCGAAGGCGCGGGCGAGGGCGAGGGCGTTGGGGGCTTAGGAGAGGGAG
AAGCTGCGCCGGGGCGGGTGGCCATCATTTCTGGAGAGCAAAAGGACGAATGATCTCTCGCTGGCCACGCACCTGAGGCTGCCGGAAGATCCCAACTGCT
CCAAATCGGATATGATGGCTACGCGAGCCATTTGGGTGAACCAGATGTCGGTGCAGAGACTCAACCCATAGTGAGCGTCAATGCGCGTGGATTTTTGCCG
AAAATCCGCGGACAATTCAAGTGAAGTGACATCGGTGCCACCTTCCTGCACGCCCGGTGCGCCATTGACTGCCGCGGCAGCTCCGAGCGGTCGAATACGT
TTTCTGCCCTGCTGACTGCAGCGGGAAGTGGATTCAGCAGGTTGCTTTGCAGGTTATCAGGCCATGCGTATTTGTGCCAGTTGGGACAGTGCCGGCGGTG
CGGTGATCAACTTCGCCTGCGCCGTCGGGTAATCCCTCGACTCGGAATCCACGGCGGAATTGTCGCTGCAGTTTGCGGTTTGCGTAGATCAACAACAATC
AGAAACTCTGGACTCTTGTTCAGAAACCGAGAGATTTTCGCCCTGCAGTTCTCTTGTGTTTTCGCTGCTCGTATCTTCGTTCTCTTCCACGTGGAGAAGG
TGTTTGTGTCCATTCACTTTAGGTTTGCTGTAACTTTAGGAAATTCTTACTTTGTGGCACTGCATTCTGGCGGCTTAAATGTTGGCACGGGTGACGAGTG
ACGGTGCTCGCCGGACGTCCGGCTGCCACGAGCTCTGCAGCGTCGCGGAGCTCATGAGCCCTTCTCCCGATCGAGCTACAGCAGTGGCAATAGGTGGCAG
CAGCAGAGTCGGAGCTGCAGCAGCGGTCGATTCCGTCCTCGTCGGGCTGTGCTGCATCCACCCTCGCGCCTCCAAAGACGGCTCCATTTTGGCCAGAGCG
GCGACTCGAAGCATAGCACGAGGGCTCCTCGGGTAGGACTCGTCCATCCATGTAGAACTCGATTCACGCCATGTGTCCATTTCGTTGCTGTATGACGGGA
GCGTATTACCCATGGCCACGAGTCCTGCTGCTCGCTGCAGGTCTACAAGTGACGGGGTGGCTCGTCGAATGTACTGCGTTGTAAGAGGCACCGCGCCCAG
TTCCTGCTCCAGTTTCATGGTGATCGAGGCACGCATGCGCATGCGACGCTCCAGGTCGAAGCCGCTTTGCAGCGGCAGGTGGTTGGGCAACCCGAGCACG
GCCTGGCCGGCCTTGCGCTTCTTGTCGAGGCGGCGCTGGTTGCTGTTGGCCTTTTGCCGGTGCATCTCACACAGGTTGTGGCGCTCGCCGTTGCGCTTGA
TGGCGCGCAGGTTCCAGCAGCGTTTGCTGGCGTAGCGGCACTTGAGCGAGCTGAACTCGTCGTCGGTGGTCTGCATGGACATGGCAATTTTTCGACTGCG
GTGGGAGGACGGATGTGTCAAGGCGTGGCAAATTCAAGAGTGGTTGGTACCAGCGTCTTCAAGGTGCGAAAAACTCAGGAACGTCGACTTTGTGAGAGCG
CCGGCATTTTTCGGAGCTTTTCAAAGACGTAACTGCAAAGGAGCTGATTTGCGTTCGGAGCGAGCAGCCTCCGCGGCTCCGGACGCACCGAGCGATCTCG
CTTCACAAGCAGTCGCTGTCAAATCGTCCCATGGGGGGCATCTGCGTTTGCAGCGATCGCGGCGATCAACAACTCGGTCTCCGATCAGCATGAGATACCT
TTGCCACGGTTCCTGCGCGGCCTGATTTCCCGAATCAGTTTCGGCGGCTCAAGCAATTGGTACTGCACTTGCGAGCAACCGAGCAACGTTAGCGGGCCGT
GCCAGCAAGAGCGAGACGCCCCGGAACTCGACTCCCGCCAGGAAACGCTGCGCCGCTGGCGAACGGGCGTTTGCTGAATAAGCCCCATCTGATGTCGTCG
GCTGAAGTTGCAGCTCGAGCAAGCTGGCAGGAGAAAACTATCTCGGTGCCTGACCGAATCTGACTCAAATCAGTGGGTTGCCACGAACATCGCGTGAGGC
AGCTTCCCCGTGCTCTGTGTGCCACGCAACACTCTCGGTGTCTATACTGGCGCCAGCATTGTCTTTCCTCTCTAGTCGGGACTACCGCACGGTACACGCT
GACTCACACTTGCGCCGCACGTTGCGGTACACTTGCGAACCTTGAAGTGTTGACCATCTTGTCGACCTGCTACAGCAGGAAGGCGAATTGAGCCGGAAAT
GCCAACGCGTCAACAACGAGAACGCGAATAGAGGCCAGATAATCGCTTGTCGTGTTGACTTAGCGCACGCTCGGGCTGGCGAGCATGTAGCGTTCGACTA
CATTGCACTGTGGTCGGAGTTGCAAGAGGAAGCCGGCGGCAATGCATTGGATGTGATGTCTCCTCG