Description :
From Genome Similarity Track
Location :
Scaffold_78:99456- 101986
Sequence
2530 bases(100 bases per row)
GGAGTCGAGGAAGACTCCCTGTTGTTATGGTTCGTCGAACTAGACAGAGACATAAAGGCACGTCGTATCGACGATGGGCAAATGAAACTCACATTTGCTC
AAGCCAACTTGGCGGGACGTGCCAAGACTTGGGCCTTAGGGCTGGAGGTGAGCGACCCATATGCTTTTGAGTCGATGGAAGCCTTTAAAACTCGACTTAA
ACAGACGTTTGAGCCGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCTGAAAATCAAGCAGGGTAAGCGTGATGTGCACGCTTACGCTCAACATATA
CGACTCTTTGCGAGTAGTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATACAAGGGCTCGTAGATGGGCCTGTCAGTAACCACC
TGTTCCGCTTAGAGTTGGATACGCTTGAACAAGCAATCTCAGCTGCGGAAAAGAAGAACTTTAGCATGAGACAGGATCATGCTAGCTCGCGTTCTTATCG
TCCACTGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATTTCGAGAGCGAGAGACCTCGCTCTTCGAACAACAAGCGATTGCAGAAG
TGCAATCGTTGCCAGAAATTGGGACACTACGCTTACGAGTGTAGTGCTCTACGCCCAGTACCAAACAGTACAGAGCGAAATGATCGGCCATTTGCCAGAA
AGGACAATGGACGTAGGTCTGACGCTGTTGCGAACCGCAACAGCGAAGTGGGCCATCAAAAAATGGTCGGGGTCAGTAGGGGCGGAGAGCCCTACTGATC
CAGCAACCTCAAAAGAATTTGCAAATCTCTTGACGAAAGTTGCTCCAGATACACAATCATTGTGTGTCTCTGCACCTGGTGATGAGGTATCACTCATTAC
CTTGGAATTGAAAGTGACAAATGATTTGTCACTTCATGCTCTAGTCGACTGTGGGGCGTCGAACAATTTGTTCGTCGTCAGTCGCTAGAGGGTCATAGGC
TCAAGTTCGTTGAGCGCTACATCCCTCAAACGATGATGACGGTGTGCCTTGCCACATGCGCTTCGATAACCGTTGAGAAACGTGTACTAGGAATTCACTA
CACGTTAGAGGGCGAACAGTACACTGATGATTTCATCGTACTGGATCTGGATGACAAATTTGATGTCATCCTGGGATTTCCTTGGCTCACAAGGTACGAG
CCAAGAGTGAGCTGACAGCATCGATCCGTGAAGATGCCTGCCGCTTGTTCATCAGATGGCCATCTGATAAACGTCATGGAGCGTCCACAGGCGTGTGGAT
GTACTGCGAGTGAGTGCGATGGCCTTACTTGCGGTACGGTCGTTAGCACGACTGCACAAGACCTCAGTGTAGCTAATCCCTACATTGTGGAGCAAGCTCC
CGGCGGCTGTACAGAAGTACAGGCAGCGCCGAAGGTCCACCACTCGAATGAGTCGAGTGGACCGGGACATGGATGCATGCCTAGCGGTCAACATCCTAGG
AAGAGGAAATCGGTTGCCACCAAAGGGAAACACGGTCATCCTAGGTCGACTGAAGAGTCGCTCGTAGAGGATCAGTACCTGACTGTGGTTGCACAGCCAC
AGTCAGAAGACGTCGAAGGAATAAGTCCTCACGTACTTGAGGAAGAAATTCCTCAAGAAGTTATTAGTGAGGTAACGAGACCTCATCATCCTGAAGGGAA
TAAGTACCCAGCAGCCTGTGGAAAAGGGTTCCCAGGAAGAAACCAAGACATTGAACGTCTTGGTCAATGACGGATCAAGCGTAGGCGCTTATACGCTTGA
TCTGGTTGTGCCTCCGAAGTTAACTTCGGAGATAACTCAGTTTCCAACGCAGGAACCGAAACGGTTCCTGCATGATCTGCGTAGTGGCAAAGTCAGGCAG
ATCTGCATACTCGTCACAGAGGATGAGTATGTAGTCGATATTCGGTCGGCAACAGTATTTGCTGAGAACGAACGGGTTCTTAGCAGCTCATCGATGGACA
AAAGTGTCCTAGATGAGAAGACTCGGATTGAACGATACACGTCTCTATCCCGGGGGTTCGCTTCAGGCAAATCCTTTGTATAAGGATTTGATCGAATTCA
AGGATGTGTTCCCTGAATCCGTGCCATGCGAGTTGCCAAAGGACAAAGGCACTCGACACGAGATCGAGCTCAAACCGGGCTCGAAGTACTGTGTCATGAT
GGAGTGGCCACTGCCTTGTGAACAAGTACTAGCGATCGACAAGTTCTTTGCCGATCGCTTTGCAGCGGGCCATGTGAGGGAATCAACTTCCCTCACAGCT
CCCCAACCTTCTGTGTGCGAAAGGCCACAGGAGGGTGGCGGATAGTGCACGCATTCAACAAGTTGAATGCTGCAACGGTACCGGCTTAGACGCCGATACC
GAGGAAGGACGTAATCATAGATGGTATGTCAAAAAGTACCATCTTCTCGTCCATGGATATGATGGATGGCTTCTATCGGATCCTCATGCGTGAACGGGAC
ATCCCGTACACAGCAATGAGCACCCTGGAC