Description :
From Genome Similarity Track
Location :
scaffold_137:9944- 11982
Sequence
2038 bases(100 bases per row)
TTGGCACTGTTGCCGACATTGAAAGAgctggttcagcttgtgGAAGTCACTTACGACGATTTCATACACGACCTCGAGTGTCATGGTATTGAGGATGCCG
TGTTGCTCCATTAGAAGGTCAGTTCAGCGGAActacgctcatcatcagttaCGGATGACTCGGCTCTCGAAAGAATTTCGACAGCGTGTGGAATCACGCA
GACTTATCATTATCATTCGTTGTTATGGAACACAAGGATGACGTCCTGAGTACGAAGCCGCCCTCCGGTCTTCCATCCAAACGTGGATTTAGACACGATA
ATCATCGTGAACCCGGTTCACAGTATGCAGTGcttcgacagtggccactgtcgcgTGAACAAAGTGAGTATGCAGTGAgttctttgctcaaaaaaAAGCT
GCCGGTTTGGTGAGGAAAAGCAAGTCCCCTCATAGCGCGccgacgttttgtgtgcgCAAGTCAACGGTGAATGGAGTATCGTTCACGTCTATAACAAGTT
AAATGCGCAGACGATTTCCGCTCAAACGCTGAATTCGCGCAAGGATGTCATCATCCACCGTATGTCTGGCTGTATACCGTTTAGTGTACCTGCTTTGGTT
GATTGATCTTGATGAGGAGGAGGGTGTCTTTTCGACGGCTGTGAGTACACCGTCCGGTATGTCATGGGATCTGCTTGTGCTGCCACAGAGACTATCCAAT
ACTCAGTACCGTTCAATTGATTGGTCTCCCATCTGTTTCGAACATTACGATGCTTTGCACAAACCTATTTTGCCGATATCTTTGTTCATTCGAAGGACGA
AGATGGCAGACCTGCCGAAGAAATGCACTTGGAGCACCTCCGTGCAGTGCTGAAATGAGTGCGTGAAAATTCATTGCAAGCGAATCTTGCAAAGTATAAC
TTGGTGCTAACAAAGTACCAGCCTTGGTTGTTATGTTTGTGAACACGGTGATTGTGCAAACCCTGGAAAggtcaaagcaatcgtgAAGTGGCCAATAACC
TGCATTGGATCTCGGGTAACTACGCGGAAATGGTGCACCCACTATCAAACTTGTTAAATAAGGACGTATCACGGGAATTTACATCCACTTGTGAACAAGC
ATCCACTCAGATCAAGCACAGTTTGATGGAAGCAGCATTACTTGCTTTACCAGATGACACGAAGCATATAGCGTggtgtgtgacgctttgAATTTGCAAT
CGGTTGTGCATTTTTGTTAAAGGACTCAGAAGAACACGGTCGTGTTGTGTCATCCCAATCGCGACAGACTAGCCTAGCAGAAAAGGACTAACCTGTCCAC
GACGAGGAGACTTTgtcaatgaagtatgctctgGTGAAGTTTCGTGTTCAGACACTATAACCGATTGATATGGAACTCCATGACAAGCTTCATAGTTGCT
TAAAGTCATGGATGTATTGCCATGCAGTTAGGAATGGCCTCCTTCACTATGAAGATGCACATGACGACGAGCAGCGGATTGAGGTTCTCCACAACGATAA
TTTGAGGCACAAGATCGTGTACGACGCGTATGATACGCCGATGGCCGATCATTTGGCCGAAAGAAGACCTACAAATCTCTCAGTGCCCTATTTTGGTGGC
CCCACATGAACAAGAGGTTTGCACGCTATGTGAAGACATGTGATGTTTGTCAGTGCGTGAAGAGCGCAGGCCCACCCAAATCCCGCTGCAGAGTTTCTCT
GTTCCTACTGGCAGCTGGAAGTCAGTAGGTCTCGACTAATCTTCGTTCCTCAAAAATGGGTGGTCACAATGGAGTGCTCGTCTTTGTtgacagactcagc
aagatggtttgcaTCGCTCCTTGTAGCGATTCCATCGACGCCGAAAGTTCGGCTagattgttcattgatcacaTTTTCGCAGTCACAGGTTGCCAGACGT
CGTCGTCTCTGATCGTGATACATTATTCACGAGTGGCTTTTGGATAGAATTCGTTCGAATCGAATTCTTGGTACTCGCATGGATATGTCCACTGCGATAC
ACCCGGAGACCTATGGGCAAACAGAACGTCTCGTCGAT