Description :
From Genome Similarity Track
Location :
Scaffold_444:9944- 11619
Transcript NameFunction/comments
Phyra_49208GagPol, putative

Sequence
1675 bases(100 bases per row)
CTTCGGCGATCAGAACGTATTGCAAACAGATCACTCGGTCTCGTACTCAGCGCTGCTCATGTTACACTTCGTGAGGTAATTCAAGAACCCCTGAATTTAA
AAGAAGCAAAGGCCTCCACTGAGTGGCACCTTTGGGAACAGGCCATCCAGGACGAAATCAAAGCTCTTAGGGCAAACGATACTTTTGATATCGTCGAACC
GCCAGTTGGAGCTCACATAATTGGGTCAACGATCGTATTCCGAGTTAAGTTGGGCGAAAGTGGGGAAGTCGAGCGATTGAAAGCACGAATCTGCGCTCAA
GGCTTCACCCAAGAGTTCCTAAAAGATTATTTTGAAACATACACCCCGGTTGCCAAGCTGAACTCCATCCGTGTATTTCTTGCGTTGGCTACTCAAAAAG
GGATGCGCGTACGCCAAGGCGATGTTCCTACGGCGTACGTCAAGGCAGCGTTGTCCGAAGTACTTTATGTCCGGCAGCCCCGCGGGTTTGAGGAAGTAAG
TCGATCCCATGTGTGGCGACTCAAAAAGGCATTATACGGCCTTAAACAAGCCGGCCGGGAGTGGAATGTGGAGCTCAACAGTTGTCTCATCGAGTATGGA
TTGTGTTCAACAAGGGAGGATCCATGCGTGTACACCCATCCAACTAACGAACTAATTGTTCTTATCTACGTCGATGATATTCTAATAGGTTATCATGATG
AGCAGGTACTAGAACATTTGATGCAAGCTCTTTATTCCAAGTACCAGATCAAAGATCTTGGAGACGTACGGTGGTTTCTCGGCATACGCATAAACATGGA
TACAGCTCGTGGAATCACCACTCTCGACCAAACCCAATTCGCATCAGAAATACTGCGACGTTTCGGTATGGAAGATTGTCGACCCCGAAAGACCCCGTTA
GATCAAGGCACGATTTTATACAAACGAACTCAACATGATGATGAAGATCAAGAAAACCCTTATCGACAGGCTGTCGGAGCCCTTCTCTATCTCGCGCGCG
TTACCAGGCCCGACATTGCATTTGCGGTGAACCAGGTTGCTGCGCATGCCTCAAGTCCAGCTCAGTCTCACTGGATTGCCGTGAAAAATATTCTCAGGTA
CATTGAAGGAACCAAGAACATGGGCTTGATCTACAAGAGAAATAAGTCAACTGTCCCCGCCAGAGTGTACACGGACGCTGACTGGGCCAATAACGAGGAA
GATCGGCGATCAATCTCTGGAGTTCTCGTTCAAGTTTTCGGTAACTCTGTGTCTTGGCAAACAAAACGACAACGACTTGTTTCCAAGTCCTCTACAATTG
CTGAATACATTGCAGCGGATGATGAAGTAGAAGAAGCATTATGGACACGGATGCTGCTTCAAAGACTGATGAAAACTCAAGCTCTCGACGCAATTCCAGC
GATGATTGACAACAAGTCAACCATTCAAAGACTGTTAAACGGAAAAAATTCCGAGGCACAAAAGACAGTTGATTGTAGCATCTTCTCGATACGGGATGCT
ATCCAATCTGGGCATCTACAGCTCAAGTACTGTCCAACTGCAATTATGTTAGCTGATGGACTGACCAAGGCTCTTGGATCTACACGATTTAGTGAACTGC
GTGAAGCAATTGGCATCGAAGAATTGACATCCAGCGCTGGTGGGGAAGTGTTGAAGTAGCCAGCCTGAACTTATC