Description :
From Genome Similarity Track
Location :
Scaffold_105:99435- 101742
Sequence
2307 bases(100 bases per row)
CCTCCGCCTCCGCGCTCAAAGTACAACTGCGCCTCTGCGACTGGAAACACCCCTGATTGGTTGTGGGGAAGCTGAGGACGACCCACTCGTCGTGAGAGTT
TCCGAAGTCTTTCTCCAGTTGGTGCAAGCCGAAGCGCCGGCTACGTTTTCCAGTAGGAGAGTGATCTCCGTTCCGCTCAGTGAAGAAAGCAGCGTCGAGG
ATCTACAAGAAATTGTTTTCCAGAGTTGCTTCGGTGATTTACCAAGCCACATGATTCCTGCCAAACTTCGAGTGTACGAAGACCTCAAGGCATGCCAAGC
AAACCTGCCTCTAAACGTTTGGGCTACATTAGGCCATCGAGGTCAAACCGCGGACAACCCACTCTGTGTAGTGGTTCCTCCACCCATGCATCCTGATCAA
CACAGTCGATTTGAAGTCGGAAGTGCCTCTTTCTGGACGAATGAGTACATGGAGGTGAATCCACCCGAGCTTGTTTCGTTTTGGAGCGTGTGTGCAAAAG
ATTCTACCCAGATTGATCAGGATACCGTGCTTAACCTACCAGAAGGAGCGTATCTTCTCGGGGATCCGACACTTGGCTCCAAGGTCTTTCTTCGTCGTTG
TTACTCGAAACTGTTGGATATCGGAATGAAGACACTCGACAAAGACGTGAAGAGCTACCCGCAGCTTTTGATTCTCGGGAATTCTGGTGTGGGCAAAACG
TTTTTTGGCTTTGTCCTATTGAGGTTTCTTGCTCGATCTGGAGCGACTTTCGTCTACGAAAGTGCAAGTATGGGCGACCGGATTCTGTTCGCTCCTGGCC
TGGTGGTTCGAGGATCTGATCAAGATTTCGCTAATATTCTCCGAACACCGACGACTTACTACATTTCCGATGGTGGGAAGCCAAGCCACAACCCGTGTAT
GACGGTTTGGTTGACGACGCCGCAGTATTCAGTCAGCTGCTTGTTTGGGAGAGTCAACGCTCTCTACATGCCAACTTGGTCGAAGGAGGAGATTCTCAAG
TGCCATGAATCGCTGTATTCCAGCAATATTCCTATCAAGAAAGTCGAGGAGTGCTATCAACGATGGGGTGGCATCCCGCGCTATGTTCTGCACTTAGCTC
AGTCGGATTCACACCAGCGGCTGCTCCAGGAAGCGATTGGGAGTATCAGCCTTAACTCTCTAATTGGCGCGTGTGTAAAGTTTATGCAGGATGACTACTA
CGAGTTGCACGGGCTGCTGTACTATCGTGTCAACGAATGTTATGGCAAGGAGAGCTTCGTGTTTGCATCTCGTTACGTACAGCAAGAGGTCTACAAGCAC
CTTTACCGGCATGACAAGGATGATCTGTTGTGGTTTCTTGGGAAGTCGCACGTCGGCGCTCTTGCTACGTTGCATTCTCTTCTTGTGAGCAAAGTGACTT
CTGGGGGATAAACTCGGAAGAAAGTCTAATGCCCCAGCGAGGTGATCAGGGCCCGAAAAGATTTGGAATAAACTTGCTGCTGCCATTTCGTCTGGATCAC
CGTTAGCTTTAGATATGCCATGCTCCTTTAAGAAAAAAAAACTTGAGCTACACTCGATTGATTTTTGTAGTAAATGTAGTACTGTAGTTGATATAGCTTT
CTAATTGCGATAACAGTTCATGTGTTAACTTTAAGAACTCTGCATCGACCTTTTCGTCGTATTGGTCGTGCAAGACTACACAATTCGATTTTGCAGCCTC
GACCTAGGGTCCGCATGTGCGAGAAGTAAAGTTTAGTCGTAGAAATCCAATACCTGCAGACCCAAAACAATGTTTTAATTTCTAAAAGGTGCAGGTTCCT
TTTGAGACGGTTTCAAACGAAATGATGCTTAGGCGCCATTTGGAGTTATCGAGATAATCGCGTTTGAAGTTGACCAATCAATTTTCGGAAATAACCGGAC
ATCAAATTTTCGAAAGTGAAAAGCGCACGGAAAAAGCTTAAAACCACTCGGAATCGCTTGCTGTTAGCGCGAGCTTTCCAATAATATACAATACATTAAA
ATTGAAAAAAATATTGAGGTCACACGTCCCAAATAAAATCGTGAATTTAGGGGGTCCGAAAATGGAGATAATTTTTCTAGACCGATGTCACTCCGCGAGT
TCTTAACATTTCAAAGCATTCGATAGCTTAAACGAAGCACAAGACACGCCTCTGTCGATTGATGCGGTTAAATCGCGATTCATACTTAGGTTCGTAAGCA
TCTTTTCGTTTGAAACCGTCTCATTTTGTCTCGACCGTCGCCAGCTTTGGCATTGTGGATGTATGATTGTCAACAAGTTAGAAATGGCGAGACAGCTACA
TCAGAAG