Description :
From Genome Similarity Track
Location :
contig_26:99412- 106136
Transcript NameFunction/comments
g5445.t1RNA polymerase I-specific transcription initiation factor rrn3, putative
g5446.t1conserved hypothetical protein

Sequence
6724 bases(100 bases per row)
TGTATGAATCGTTCTCGTACCAGATCACTAGGAAAGAATTCCGACAGCTGTATTATCTTGTTTACGGAGTATATCCATCCTACTCGTATTTCGTGTCTAC
CATTTCGAACCCAGGATTGCAACAAGAGAAGCATTTTGCTAAGCAGCGGGATGGTGCACGCTAAGACGCAGAACGAACGTTCGGTGTACTGTAAAAGCGT
TTTCGTATAGTAAAGATGCCCAGTCAGATTTGGTATCCAGAAGACATGCTCTCCGTCATAAAAACATTTTGCGCAATATAATCATCGAGGATGAATGGGA
AGTTGACGACTTGGATGAATTACCAGAAGAAGACACACACGTTGATACGACGAGTCGAGTGAGGAATGACGGTGTCCGTGAGAGAGAGGAGCAATTGGCT
GTGGGTGAATAATCACGAGACGACTCCAAATACAACCCGAAATTAACCATCTAGTGCTGAAAAGATCTCTCATTGATCACTTGTGGGGTCTGAAAGGAAA
GCAGAGTACGTTAGTGCAAATACTTATAATCCACCAAAGTGATTCTACGTAGCTTACCCGCAGGCAAAGAGTTTTCACCATCTGCATTGTTCTTGTCAAG
GTATCCGACACCTCCAAGTTCATGAGTATCCACCAGATTACTTTGTTACTCCAGTTGCTCTTAGACGCGCCGCTCTTCAGGCGAAGAACATGCACAGAGT
CCTCATCCCAGCCGTCCAATTTGGCGGAACTTATTTGTTCTGTTCACACTATTGCAAAACCGAAATGCGTAGCTCTTCCAGTTCTGCCTTACGCTTCGAA
ATCTTGACCATCTCCATAGCTGCATCTGCCATCTGTCGGTTGCTTGCTTCTAGTGAGCGCACAGCCGTTTGCTTCTGGACACCAGCAGCTCGCTTTGATA
TATCTTGTGTAGTCGTGTCCGTAGATAGTGACACCATGCTATCGTTGTCATCACCATGGGCAGCCACGTGCTTTTTACGGGCTCGCAGGTAGTGTCAACC
TCTTCGGTCGACTATGAAGTTCTCTCCATCCTTCTAGGTGTTTGAATGGGGTATCCTGTTTGCTCTCGTACATGGTTACCGCGTCTTGGACACGACCCTC
ATCGGTTTTACCACTTTCGTTGAGCTGTTTGATGGCTACAACATACCCACAGAACTTACCCACTGGTGTGAGTCCTACGACGAAAATTGAGAACTGATTG
AAGAAAGATTATCCTGGCTTCTTGCTAACTACCGATGCAGTGTCCTTGACGCTAGAGAGGGGCACACCCAGTGTAGAGTTTCAATTGAACCCATCGACGA
AGGGTTTTTACGCTGACCCCAAATGGCGATTTACTGCCAGGAAGAGTCTTAATTTACGTCTGTCCTAGTTTGGTTCCTGCGGTGGAGAGAGGTGACCGTA
ATTCATCGAATAATTTGCTGCTGAAACCTCAATTTTCTACCGAGGTGGAGACACCCTCATATTTCGGGCTAGGACAAACGCAATCTAGCGTTTCTCTCGA
TGGATCTAACAGATCGATCGATCTACCTCAAATCGATCCCTTTTGCATTTTTGAAAACGCAAATCGATCTATTTAATTCAAATAAAATACTGGTTTAAAC
ATGTATCACATAACTTTAGACCACCGGAATTCCGTCTAAGTACGATCCATTGTCACCCGCTCATTTAACAATTGCGACCACCACGACTGCATCAATCAAT
GGGAGCCGCCGCCAGCAAGACTTCTTCGTCCGCCGTGGCGCGCACCCGTGTGATCCGCACCAACGTGTCTCTGGAGCAGTTGGTGGCGCTGTCCCGCGGC
GGCGCAGCGTCGGACCTGCCGTCGCAGCCCTCGGGCCTTGCCGTGGAGACTTCTTCGACAACCGTGGACGCGCACGGCTCTGAGGTGGAGCTGCTGGAGA
TGCAGCAGCAGTTGCTGCAGGACGTGCAGAAGATAGAGGATTTCGATCGCGTCAAGTTTCTGGAGGAGAGCACGCGCGCCTTCGAGGCCACCGCCAGCAG
CCACCGCCCCAGGTCCTCGCAGCCCGTGCGGCTGCCCACCGACAAGACGAGTGCCGCGTCCTCCACGGGCGTGGGAGGCGCCGACGAGCAGCAAGTGCGC
GGCCGCCTCACGACGAGGGACCTGCGTACGCTGCTGCGGCTCCACTACGAGCAGCCCAGAGCTGGACGCACGAGGTGCTGGCCGACAAGTTCGGGCTAGA
CGCCGACACCATGCGCTGCATCCTCAGCAGCGTGGGCCCGCCCAATGTGCTGCCGCCCAGAGGCACCTCCGAACACCCAATGGGCGTGTGGTTTGACGCC
CCGGGCTTGCTGCCAGTGAAATCCGAGCTGCAGTAGAGTCGCTCATCCTAAACGTAAATCATAATATGCTAGACAAATGCCAACGTAGTGCTGTCATCTT
CAATATGTCGGAACTTTGCTAGTCAACATGGCACCCAAGCCTTCCTGCTCGCTCATACTCATAGGTCGGCGGCACCTAGTTTGTGAAGTTGCCTTGCCTT
TTGTACTATCGAAGCGTTTCTGTCCGGGCCAGTCGTTTCTCGACCCACAACGGAAAAACTTAGAAATGGCTGGAAGCACAGCGTCGCTGCCCTCGGCGCT
GCCCGTGGCGGCTTCTCCATCGGAGCAGGAGGTGGCCAGCATGCAGCACTTCATCGAGAACGCGCTGGACCTGCTCGTCAAGGTAAAATCTCCTCTCCAC
AATAAAAAGACCCTTAAAAGACTCACCCATTTCCATCTACTTCCAGGGCAACGCCAAGAGCTACGACTACCTCCTGCAGCAGCTCACGCTCGTGCCCGCG
CCCGTGGCCACCAGACGAAAAATCTTCCGCGCGTTGCCACGCTGCATCTCCGCCATGGCGCGCGAGCCCAGAGCCTACCGCGCGCTGCTGGACGTGCTTT
TCAAGTTCGACATGTTGGCTAGTGGAGACCCACTCGAGGTGGACGACTACACGAGCTTCGTGGTGCACCTCGTGTCGTCCAACACGGTCTACGTGGTGCC
CACGCTGCACATGCTGGTGCGCAATCTGCGCCGCCCGCAGACGAAGGAGCTGCCGCCGGATCTCAAGGCCCAAATACAGGAGCAGGAGACCCTGAAACCC
GTTAAAACGGGTGCAATTGCCATCGGAGGCTCTTTTGGAGCTGACGTCGCTGCAGTGCCAACGCCCCTGGTGGAACCCAAGGCACCGAGTCTGGACGAAC
GCATCCAGGCGCGCTTCGAAGCGGCGCACGCCACGCTGGAGCGCGTGTTGGCACTCGTGCCGACTGCTACGAACGTCCTGTTCCCGATCTTGTGCGAGCA
CTTCCCGCACAAGCGGATGGATGCACCCACCCAGGTGGCGTACCTGCGCAATGTGCTGCGCGTGACAGGATACGTGAGCGGATTGCGTGAGCGCGTGTTG
GGGCTTGTGATCGACCAGCTAGTGGCTATCGACGTGGAGATCAAGCTGGACGAGAGCGAAGAGGACGTTTTCACCATGGATGATTTCCTAGACGATGATA
TGCTACCGCCCGATGATGCATCGCGTCAAGTGGACGAGATGGCTGACAAGCTGGACCAGATGATGCTCGTCATGTTCGAGCACATTGAGCACTCAGCTGC
ATCTTCGTCACCCGCATCAGTTGAGACGGTGGCTCCCACTGAGACTAGCAGCAACGAAAAGGATGTGAATGTGCGTCAGGCGGCATTGATCTTCAAGCAC
CTGCTGAAGGTTTTCGAGCACTCCATCTTGAACACACATCGCTCCAAGTACCCGCAGTTCTTGCTGTTCTACGTGTGCCGAATGGACCCACAGTTCCAGG
ACGTGTTCATCTCGCAGTTGCTGGCCACATCGCTAGACCCCCACACGCCGCCTACTACGCGACAAAGCTGCGGCGCCTACCTGGCCAGCTTCCTCGCTCG
AGCCAAGTACATTTCCGTGGCTTATCTTCAGAAGGCTCTATATCACTTGTTGAAGTGGCTGCATGATCAGATGGATGTCTACGACGCGGTACACCAGGAA
CAAATGGACCAAGACGAAGTTAGGAATGGCGAAAGTGCTGCTGAAAGAGAAGAGCGCCTGCTGGAAGAAAGCTTGAAAATGGAGACCAACGGTGAACGCG
GTTTCCAGGAGAGCATCTATATCTCTACGCTGCAGACAGTCTGCTATCTGGTTTGCTTCCGCGGATTGGAGATTGCCACCAACGATGATGGTGCTGGCTA
CGAGTTTTTGCGTAGTCTCGGCTGGGAGAGACTACTGGTAGCAGGTACCGGCTACTGTCCTTTGGCGTACTGCCAACAAACAGTGGCTACAGAGTTTCTG
AATTTGGTCGAGACCTTCGACTTGGTCTCGGAGGAGTGCCTCGAGCGTGTGGACCAGACTATTGGCACAGTCTCTGCGTTAAGTATCAAATCCGCCAAGT
CGATGGAGCGGTCGAAGAAGCCCACAGCAGGATCGGCTCCCGCTGCCACACTGCTTGGCCAGCGCCAGCCGCTTGAAACTTTCTTCCCTTTCGACCCATA
TCTCCTGCGCCGGTCTTTCCGCTACATCGGTCCGTTGTACCTGTACTGGAAGCACGCAGACCCGACGTCGAGTGAAAACTGCGCACTGTTGGAGTCTGTC
AAGTCCACCATTCACCAGATGCAGGAGGATGCTGAAGACGAGGAGGACGATGACAGTGAAGAGGAAGAGGATCTGAGAGACGAAGACGTGAGCATGGCCG
GTAGCGCGCCGAACCCAATGAGCCTTTCGAACGCTTCCTACCGCGCTGACAGCTATATGGGCAGCCTCAGCCGATCCCACAACATGTCAGTTGGCTCATC
CTACGACGGTGAAGGATTTGGCGACGAAGATCGCGCACCGGTAAAACGGACGCTGCCGTCGCGCACTATGTTCGATCCGTCCCCAGCTTTGTCAGCTAGC
TCACCTCCGTCGCGGCTTCCTCCTCTTGGCTCTGCCGATGCTTTCACGCTTGGGGGCTTCGATGATGACAACGAGGACGATGGATTCTAGGGAAACAATA
AACTAAAGGAATAATGGACGTGGCATGAATGCAAGAGCTCGAGTTACACCACGATGGCCTGCACCAAGAATCAAAGGATTGCAATAAGCTATTCAGCCAC
ACGAGGGCGGTGAGTATACATAAGTAAAGTGAGGCGGAACAAGTTGCAGCAAAGGCCACAGCTACCCAATCTCCAAGCCACTATCTCCAGTATCGACACA
GTCTTGCTCTCAGAATTCGAACACGCTTGCCGTGACTGCGCAGGGCGTCACCAGATTCAGCGCTCTACCGTCGGTTCAGCTGCGCGCGGAGTTGCTCGTT
CTCATCCTCAAGACGCACGAGTTTGGGAACAACCTCCGAGTCCACTTCCTCGATCTGGTTCTTCAGGTGGTGGTTCTCCTCGCGCAGACGCGAGACCTCT
TCTCGGAGGTACGTGTTGATGTCGAGCTGCTGCTCCAGCGACGTCTTGGCCTCCAGCAGAGCGTCTTCCACCTCCAGCTGCTTCACGTGAGCCAAATCCG
CTTGCTCTTGCACCATGCGGTTGCAGTCGTCCATGATTCTCTCCACTTCCTCCTCTTTCTGGGCGATCTCGCTCTTCTTGGCTTCCAGTGACGCCTCGTA
GCTTGTGATCTGTTCATGGCTGGAACTCACCTGCTCCTGGTGCTTGTGTAGAGCCTCCTCGTTCTTCTCCAGCTGAGCGCGCAGCGTCTGCATCTCCAGC
TCGTACTCCACCTGTCCCTGCTGTTGGCTCTGCGCGGCTCGCAGCGTCTCCTGCTCGTTCAGCAGCTCGGTGATCATCTGCTCGTCCGCGGCGCGCTGAC
TCTTGATGGTCTGCAACGCCGACGTCTGGGAGCTCAGCTCCTGCTGCAGCTTGACGAGCCTCGTGTCGATGACGCGGCGACTGGCCAGCATGTCCTCGTG
CTGCTGCACCTGCCTGTCCTGCTCGCGCGCCGTCTTGCGCTCGTCCAGCATGCCAGTGAGCTTGCAGATCTGGCCCTGCAGGAGACTCTTCTGCTCGCGC
TCGAGCTTGAGCGCGTGCTCGAACACGGTGCCCGAGCGCTTGGCGTCCTCCTCCTCCGTGAACGTGCGCACGTTGGGTGAGCGGCGACCACTCGCCGCAT
TGGCGCGCAGCCTCGTGCACCACGCGCACGCGGAACACGTATGTCTGCGTGAATATAGTGTATATAGAATAAGAAAATCTTCAAATAAATCACCCGTTTC
TATAATAAATGGGTTGATAGGAGCCGTACCGTGTTGGACGTGAGGCCTTTGACGGGGAACATTTTGCCCGTGAAGAGCACGGACTCGTTCCACGAGTAGT
AGACGTAGCCGTGCTCACTGTGGCTCTGCAGAACGGTAAGAAATAAATGTTAAAAAATAATAAAAAGGTAAATAAAGTTGGGGAACCGACCGCCTGCAGT
TTGTACTGCGCCTCTCCGTCCGCTTGAGGCGGCTTCTCCACGCGCAGCGAGATGGACTGATCCGTCTTGGACACGACCTCCGGCGCTGGCAGCGTCGGCA
GCTCTGGCATCACGGTGAACTGCATGGCGGCGGTGGCTTCTTGATGCTTCTCGTTCTTCTCGTTCGACTTTCGCAGACTGACGTTTTGAAGCAACTTTGT
TGGCTTCATGCAACCGAAGCGCAACGTTAGCGCAACCGAAGCGATGAAAGAGGACAGCTTGAGGACATGGCTACTGTACGGTGTGCTACAGGCAGATCGA
CTCGTCAATTTTCATGGTGTGCTC