Description :
From Genome Similarity Track
Location :
Scaffold_183:994- 23520
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_183-snap-gene-0.7Collagen alpha chain
Pytiw_DAOMBR242034maker-piw_contig_183-snap-gene-0.9Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_183-fgenesh-gene-0.3Conserved gene of unknown function
Pytiw_DAOMBR242034snap_masked-piw_contig_183-abinit-gene-0.14C2 domain containing protein
Pytiw_DAOMBR242034maker-piw_contig_183-snap-gene-0.12Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_183-fgenesh-gene-0.1Cytosol aminopeptidase

Sequence
22526 bases(100 bases per row)
CATGCTGCCGGCGCTCTCGACCAAGCCCAAGCAGGCCGTGCGGCAGGTCAAGGGGCTCACGAATGACTCGATCGACGCATACTCGAACACGCCCATGGGC
GGCAGTGCCATGACATCTTACGCAGACAACACCACAGCGGATAGTGGTGGCGGTGGGAACACGGCTCGGGCCTCGCCACCGTCCACCAGCAAGCCCGTGG
GGGCTAGCAACGGCCGCACGACCTCGAGGAAAGGCCACGACGAGGGCAGCCATGGCGGTGGCGTTCTGGCACGAGTCGTGCGCGGTCGCAAGGCCTCGGG
CGAAGAGGAGCTGAGTCTGGAAGCCGGCGATGTCGTGCGTGTGCTCTCGGCCAAGCGCACCGGGTACCTCAAGTGCGAGTTCGCCAACGAGATCGGGTAC
GTGCCGTCGTCGTACCTCGAGTTCTTTGACGAGAGCGGTGGTGGCACTGGCGGCGTGGATGCCGATGGCGCTATCGAGGAGAACCAGCGCGCCGAGAAGC
GTAAAAAGAAAAAGGAGAAGCGGCTCAAGGGCAAGAAGCAGGACTCTAGCGACCCTGAGGACTCGACTGCTGTTGTTGATGCTGCGGCTTCAGCCAGGTC
GCCTCGCAAAGCCAAGGACGCGGACGCTGCAGTGACTGGCGACGAGGGTGACGTGTCGCCCCGTAAGAGCAAGAAGAAGGGCAAGTCGTCTTCCTCCAAG
CACCACCACCACCATCATGCTGACGATGATGGCGAGCCACTAGACACGAAGCGGGGCGCAACTGGAGGAATTGGCGAAGACACGGAGCGTCGGAAAGCCA
AGAAACCGCACAAGAAGAAGCACCACCACCACGACAGCAACGAGGCTTCGAGCGAGAGCGACGATGACAATGGCGGCTCACGCAGCCATCGCAAGGGTCA
GCGTCACCGGAGTCGCCGCCGCGGCCATGGACGCGGTGGAGCGGACAGCGGCAGCGATTCATCGTCAAGCTACTACAGCAGCTCGGACTCGGGCTACTCG
CGCCGACGTCGGCGCCATCGTCACCGCAAGGCGAGCTCAAGCGAGGACGACGACTATGACACGGGCGATAAACGTAAATCCCGTCACCGAGGTCGACACC
GTGGGCGTGGCAGTGGCGGCTCGGACGCTGAGGACGGTGACTCAACCACGCGCTTGGCGCGCCGCAGCGACAAGAAGCGCCTCGAGGCCGAAGCCACCAC
GCCACGTGGGGGCAAGCCTGGCAAGGATAAAGAGCCAACGGCATCGACGACCACAACAGCAGCAGTGGCCACGAGCAGTGTCGAGAAAAGCGTGGGGAAG
CTCGAGGTGCATGTGGAGAACAAAGGTTCGTCCCGGTCAGAGATGATCTCGGACCACACGCCCGAGGAGACCACCAAGAAGACCTCTGCGACAGCGTCCT
CGTCGACTACAAAAGACGGTGGGAGCAAGAGCACGCGAACCAAGAAGGACGACGAGAGCCGCACCGAGTCGGGCGTCGCGGCCCAGAAGGCCAAGACGAA
CTTGGGCAAGCAAATCGGCGAGAAGATGCGGTCGCTGTTGGGCGGCGGCAAAAAGACTGAGCGCTCGCACAAGAGTTCGAGCGGGATCCTGAACGCGTGC
CCCGGCACGACCCAGGGCGAGGAAGGCTGGTACGAGCACGGCGAGAACGAACGGTACTACTTTGTGCTCCTGGACGGCAAGTGGAGCCTGCTCTATGGCC
CCATGACTGAGGAAGACTTTGAACTGTACTCGACCAAGGTACTGTTGAGCTGTCTCGTTGTTAGGCTGGGTTGTTATATGTGGTGGTACTGACTTGCTCT
TGTGTGAAACTTGTCTCGTGTACCTAGGTCCTGGATCAGAACCGCATGGTCGAGCTGCCGCCGACGTACCTGCACAAGGCCGGCTACTTTCTCAACCAGG
AGTTGCGAGTCCAGAAAGTATGAGCGCAGCTCTTGGCTAAGAGAGAGAGAGAGATCTTCTCCAGCTAATACAGATATTAACCCCTTGATTTATCACGAAA
CTGGCTGTCGACAATTTCCAACATTGTCGGAAAAAGTTGAAATTGTCGAGCACACAATTTCAACAAAGTTGAAGCACATGTATTCATTATCAAGACATGC
AATGAACGAATCACATCACCTACATGCATCAATGCAACGAGATCGATCGATCGATCCTCACTCACTTCGCTGTCGGCGGCGCAGGTGGCGCAATGTGGCT
CGCGTCGTGGCTCACGGGCTTGGGGAAGAAGAACTCGGGGCGAATGCGCTGGGCGGGCTCGTTCGACTCGAGGAGCCACTTGGAGGGCGACTTGAGCAGC
TCCTTGATCTCATCGCCCAACGAGTTCTTGCGCTTCGCCTTGGTGTCAACCATGATGGACTGCTTGTTGGGCTTCTTCGCATCGCCAGCAGTGTCACCGG
TGGTCACTTTCCAACTTGTGTGCTTCTGGCGAGAATCCAGCGGCTGCACTATTTTCTTTGAAGGCGAGAGTTCGCTCCACTTTCCTTCTCGAGCACGTGC
TTGGGCTTCAGCTTCAGCGGCTTCGACGGTAGCTTGTGCAACGTCGGGCTCTTGGAGGTCAAGGTGCAACGAGGACGGCATCTTGCGCTGGCCGCGTCGG
ATCTCGTCGATCTTCCTTTCTAGCAGCTCCTGCTGGTTGCCGACAATGTCGCCGCCTTCGCTCACCATCGCGTAGATGGTCTCCTCGTCCAGCTCGTCAG
CGCCAGCGATGCCCTCGGTGTGGAACTCCATTAAGTTGAGCAGCTCGGGCGTGCGGTGGATGCTGAACGTGCCCTCCTTCTGCATCTTGACGAGCTCGTC
GAGGCGCGCGCGATGCGGGATCCAGTGCGAGGTCACGATGTGGTACGCCTCCATGTGGCGCGCGTGCAAGCCCTTGGGCACGACACACACCTGCTCGATC
GCATGCAGCAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCTCCTCGCTGTGCAGCTTGCGATTGTTGATGCACTTCTCAGCGTGGCCCACGAGCTTCTCGAGCATCTCGTTGTTGCGCGCGAACCGCTGCTCGAGGAT
TTCCTTGGCGGCTTTCTCTCTCGCGCGCAGGTTCGTGCACTTGTCGTTCACTTCGTCCAGCAGCGCCTTCGTGTGTACCATGTGCATCTTATTCGCGGCT
TCAAAGATCAGCAGCTTCTGCAGCAACACCTTAACACCGACGCCCTTGCTCGCGTCGTCGCACCAGCCGTAGCCGCGTTGGAACCACCGGTTGCAGAGCG
TGAACGCCGCCGCCGACCAGATGAGCCGCTGCTGGTGGTGCGCGTCAAGCTGGTGGTGGATGCGCATGGCCCTGTCTTCCGAGCCAAGGAGCCAGTCGAC
AATGGTTGCCTTAAGCCCTAGGCGACTGCGGTCTTTCGGGATCACTTGACCATCGACACTGCTCCTCTCATTGTAGGGCAGCGCGTCCTGGAAGCGGCTC
GTCGTGGGATCAAAGCGCGAACTAAAGCTCGAGAGCTCCTGGTACACCATCGCCGCGTGACACATGGCAGCGTAGAACGCCATCGCAGTTGCATTCTTCC
CATGCGGACACTTGCTGAGCATCTGTTCTGTGGGCGTTCGGATCTTGCCGCGGCTCGCTGCTTCGACCAGCTCGTCGCGCGTGAATGCCTCCAGCGGCAG
GCGGTACTGGCTGTTACACAAGTCGTGGAGTGCGATCGCAATGTCTTCTTTCGTCACGATCTGGTCGCGCGGCGCTTTCAACAGCGCGCGCGTGCACCGG
TCGAGCGCCGCGTAGGACGCCAGGCGCTTCGTGTACGACTCGTGGATTAGCAGCTGCTGGAAGCGCTCGATGAGCGTCATGTAGTCACCGCTCATGTCCA
CCTCGACGTATTCCATCACGTGCTCGTCGATCAGCACCTTGGTCTCGCCGGGAAAGGTCCTGATAAGCGAATTGCGCTTACGCAGGGCTTCAAAGAGCAG
CGACTTTCGCAGCAGCTCAATGTGCGTGTCAATGAGGCCAAGTCCCGTGTTCAATGGACTCGGCGTCGCACTTGTCGACTTCGTCGTGGCGGCCTTCACG
CCAGTGTTTACGGACGTGTCGTCCGAGATGACCGACTGTGTACCGATGCGCATCCCGCGCAGATAGATCGGTTCGCCCTTGCGGTCCATGCCACGCTCCT
GGAGCAAAGTCTGGATCCCAGCTGTGTTGAAAGGCAGCGACACGTCCTTCACCTGGTAGCGGTGCATGAGCGACAGTACGGTGGTAAAGTTGGCGGTCGA
GGGCACGTCGATGCCGACCTTGAGCAGCTCCTCCTTCTGTAGCACGACCGTGAGCGTGCGCACGAGGTTCTCGATCTCCGTTGTGGGGAACTGGCGCATC
TTCATCTCGTCCAGCAGCCTCGTAAAGCTCGCTGGGACCTCGAGCTCCTTGTTGGCGTTCACGACGTGGCTGATCTTCCAGAGCAGGTCCGTCTTGCCCA
AACTCTCGATCACAGTGTAGAGCTCGGCGAAGCGCTCCGGGTTGGCCAGCACCTGGCTGCGCACGTCGTCCACGTGCTTGTTCTCCATCGCGAGCTCGAG
CTGGTCGATCTCCTCCAGGAGGTCCTTTGGCAGACTCGAAGCAGTGGGCGTGCTCGTACTCCCACTGGAGGGCTTTGCCTTTGCACCGACTCCCGTGAGG
AACGACGAGAACTTTGGGATCACACCGCGGTCTTCCAGTGCCGCGCGGATGTTGGCAGGTGTGAACGCCATCTCCTCCTGCGTTATCATCAGGCGTATAT
CCTTTCCGTTGCGCGAAAACGGCAGCCAGTTGTTGCGGTCGTGGTCTGTGGTGATCCGGTGGCGAGGGGTGCGCTCGAGCTCATGCTTGGCCTCTTCGAT
CGCGTACCACTCGATGAGCCCTTCGAGACGACCAGCATCAACTTCGCCAGAGTCCAACATCGATGTGATCGATTGACTTCTTGGAGACACTGGTGGCGAA
TTAGCGTGAGGTTTGGTATCAATCGCACTGCTGGATCTCAACGCCATGGACGACAGTCCAGCCGTGAGCGATCGCTTCGTAGGCGATGAAGCAGGCGAGC
TTACATGCTCCAAAAGCGTGCTGGGTCCGCCGTGCTTGTGGTGATCGGCAGCTCGCACCTTCTGCTCGATCAAGTGTATCTTCTTGAGAATAAATGGCGT
GGCCTCACAGTCGATCTTGTGCTCGTGGTGCATCGCCAGCACGTCGTCGAGCCACTCCTGGACCTGTTTCCAGCGGCTCTCGACAATGTCGAGCGCTTTG
GCGTCCACGTCCGCAAAGCCCTCGCACTGTTCGTTCAGCAGCAGCACGAGCTCGTGCGTCCGACGCCAGTGGAGTCCCTTCTTCTCCATCAGGCGGAGCT
CACAGAGCGGTCCCTCGCGCTGCGTGATCGCCATCCACCGGAACTGGACATTCGAGACCGCTTCAGCGTACCGGTCGTTCAGGCCCTTGCTGCACTTCTG
GGAGACAGTGTTGAGCAATTGCGGGGCGCGTCCTAAGTGAATCTTGTTGTTCTCCTTCATGACCACGAGCTCTTCGAGTGCCTTGCGAAGGACTTGCCAC
TTCTTGTTCACCTGCTGCCACGCAGTGCTGAGCACAATGTCGAGCCCCTCGAGCTCCTTCTCAATCTTCTCCAGCAGGTACGGCGTCCGCTGGGCGTGGA
TCTGCATGGCAGCCTGGATGACCAGGAGCTCGTCGAGCATCGGCTGGATGTTCGCCCAGCGCTTGTGCACTTCGACGACAGCCGAGCGGTACTCGTCTAC
CTTCTCCGCGAGTCCTTCGAGCTGGTCTTCCTTGCTCGCCTTGCTGTCGGGTTTCGTGATCGCCTTCTTATGCGAGGCAAAGATGTCCCAGACGAGACTG
AGCAGGATCGGCGTGCGCTCCCAATGCAGCTTGCCCGTCGACTGGATTTTGAGTTCGTCCAAGTAGCCCTTTACAATCATCCAGCGGCGCCGCTGCGCAG
GGATCACGGCTGCGTTGATACGGCGACGCGCCGTCTCGTGCTGCATGATGTTCTTGGCCTTGAGGAACTTGTACACGTGGATTGCCTGCTCGAGCAGCGC
GCTCTCGGCGTACGTCAGGCGCAAGCGCAGGTGAACTCGGCCTTGGTTCGTCGACACGTGCTTGTGATTCATTTCGGCAAGCAGCCCGAGCTCGGCGCGC
GTCTCGAGCTGCAACTGGTTCGCGTGGCGCCCTCGACTGGGCTTCATGAGCTTGTACGATTCGAAATGCTCTTCCTGGTCGATCAGGTCGAGCAGTGGGA
TCTGCGCCATGCCGATCGTATCGTGGTCGTACGGGTTCTGGTCCATGATCCGCACGCGCAGCGTCGTGCCCATGATGTCGTGGAGCACCTGGCAGATCTT
GCGCAGTCGTAGCCGCTGGTACACTCGTCGGTACACCGCCTGGTCTTCGTCGTCGAGGTCTTCGACTTCCTCTTCAAAGACCCGCAGAGTCTTCTCGCCA
GCGACAACGTCGATATCGTCGCCCTTGGCGTCGTGCATGTAGAGCTCCTGGAGAGTCGGAATTAAACGGTACCTGTACATGTCAAAGAGCTTTAGGATCG
TTCGTCTCAGGCGGATCGTGGATGTGGCCACGTTCGCATGGAACACAACCATGTCGCCACGGTCTTTCACTTCGTGAGCCCGGTCGCCCGACCACGGAAG
GCGATGCGTGGGGTCGATGATGCCGAGTTCCACGGCCGTGACCTCAACCACCGCCTTGGTGTGCTTGAGTGCGATCTTGAGCTGGTCCATCGCACGTGGC
GACTGCATCTTATGCCCGTGTTTCAGAGCGAGCGCTTCTTCTGCATTCTTCCCAGTGGGATGCTTCTCAGTCTTCCATTGAGCGTGCCTGGCCTTGATCT
TTTCCATCGCCTGGGCGATCATCATCACGTTGAGGACCTTCTGCAGCTGGACCTCCTGTTCGTTAGGAGCAGTGAGCTTGACCCTCCCTCCGCTGGGCGT
GGGCGTACCAGCAACCAAAAGTCCACGCGTGAGCTTGTTCTCGTGATGCTTCAGAGTCGTGACCAGCAGCTCGTACGGATCGATCGTCCAGAGATCGTCC
TCGGCTTCAAAGCTCTTGGCCTGAATCTGGTAGTCCTTGGCGATGCGATGCGTGCGCTCAATGCAGAGCGTAATCTTGCCCACGACCACTTTGCGACCGT
CTTCGACGCGCTCGACGCTAAAGATCTGAGTCTTGAGTCCGACGTCTGGTGTAGTTGCTGTCTTTGACGATGTCAGAGTCTTTTGCGCATCCTTGGCATG
CTCGTCTTGGCTCCAGACCTGATACCGACCAATCTCTTCCATGAGGATCTCCGTCGTGCCAATAAGAGTCTCAGATCCCTTCCTCGACCTGTCCAGCAGC
CTGATCCGGACGGCCGCAACACGCTCCAAGTCAAAGCCCGGGTGGCCAAACACCGCTGCTCGCTTCGTCTCCATGTTTTGAGTCCAAATGCCCGGCTCCG
AGCCTCGGTACAACTCCACGGACGAGCTCTCGGGGTATCTGTTGCGCGCCATGTCGATGCAGATCTCGCCGGTGGGGGTGAGCACCACGCCGTGCGGCGG
CCTCAGCGCTTGCTCGCTCGCCATCTGCGGCTCAAAGTCGCGCGACACGAGCATCACCTCGGCCCGGATGCCGCTGCTGATGTCCGCCTTGCTCTTGATG
AACATCTGCGTCATCTGTACGACCTGCACGAGCATTCTGTCAAACTTGAGGTCGTCCTGGGCGATCGGGACGACTTCGCTGGACCTCTTCGCGTCAGTGT
ACTTGATCTCATAGTACGGTGGCACGACTGCCTTCGGACCCAGCAGTTTGCGAATCTGTTGCTGCTTTGAGTGGTCCTTGCCATAGAAGAGAGGTCCACT
GACGACCTTGGCTCCGTGGTACGGGGCCAGCGAGCGACGCAACTTGGCTTCAGTCTCGAGCTTCTCAGCTGATAAGCAAATCTCCTCGATCTCACTGTTC
AAGCTCTTGACACTGATGCGCACGTCGTCCAACGGAATGAGCTCCAGAGTGACCGACGGGTGCGTCCCTTTGTCGCCCTTCCTGTTCATCACCTCGACGA
CCAGTTTGCGGTCCTTCTCGACCACAACGTCAGGGTTCCCGCCCGCCTTCTCCATGATCCAGATCCCATGGCCAGCACCAACCGCTTCTGCTAGCGAGTC
GTGCAGTCCAAAGTCTGCGAGAAGTAGCGAGTTGCAGGCACTGAGGTGCTTTGTGATCTGATTCGCGTCTTGGAACGCCGTCGCAACTGCAGCTGCGAGG
CTATCTCGGTTGTTGTGCGGCACTCCGAGGTGGAAGTGCACCTGGATGCTTACGTTCTTGAGCGCGACGGTGCCGCGCTTGACAGTCTTCTTACCCTTGA
CGTCCACGACCACGTCCCCCACACACTTCGACGTCAGTGCGTTGAGCTCTACCTTCTGTGCTGCGATCTTGCTGAAGCAGATCTCCACTTTATCGACCAC
GAGAACGCGCTCCTTCCTGTTCAGCGGGAGCTCAAAGCTCGCCGTTGAACGGACGATCTTCTGCACCAATTTCGAGAACACGAGCGGATGCTTCAGCTGG
AGAGCGAGGAGCGCCTTGAACAGGCCCAGCGACTCGGTCGACGAGCTCAGTGCGAGCGTCCCGTGGATCTCCACACGAGGCTGCGGCGCGAGCAGCACGC
ACACGCAGTTGTCGATCTCAAACGGCTCTTCCGCAGGCGTATTGTTAGTGTCGTGGCTGTTGTGGAACCGCTGCATGACGGCAGCTTCGTACAAGAGCGC
AAGTTTGACCTTCTCCGAGCTTGAGAAGTCGCCGCCCTTGATGTAGCCATGACACTGGTCCACAAACCGGGGCTTTGTCTCGCTTCGCTCTTGCAGTCTC
ACTTGCATGAACTTGTTCGTCGTGGCATCTCGGAGCTGGATATTGGCGACTGGTGTGGGGAGAATCAAGTAAGCCCTGATGATCTGGTTGTTGTCCCACA
AGTCCGTCAACTTTGTCGCCATGGTGCTGACGCTGGCCTTCTTCTCGCCAGCATCCTGGATCGTCAGCTGCGGCGCGAAGATCGCACCGAGGATGTACCG
ATCAGTTGCGAACGTGTCCTCTTTCGAGCGGAGCTGGTCCCGATGGATCCCTTCTACGAGCGCGCCGTTCTTCAGCGAGATGTCGTAGTTGACAACCAGA
GTCGTCGGCTTTGAGCTTGCTGGCACGAGATACACGTGAGCCACTTCGCCTTCATACATTACATGCTCGGTCAGCGGCTGAATGCGATCACGGTTCACGT
GTGAGTCTGTCGCTGGGAGCTGGTCGTCCAAGTACTCGACTCTGTATCGGGCGTTGCCGTAGTTCTTGGTGATCTTTGCTGGTCGCGAAGCACCGTGGCT
GGCGCTCGACGCCGCTTTCTCTTTTGTAGCAGTCTTCGTAGGTGAAGCAGCAGGTGAAGCACTCGCTGCTGCTGGGCCTTCAGCGCTCTTGAGCACGCGG
ACAAAGTCATCTCGCGCCAGCTGCGCGTGTACCTGTTGTCCGTTGACTCGCGAGAAGATTGAATCGAGAAAGATTCGCGAGATCCACTCTTCCTTGGGCT
CTTTACCATCCTCATAGACGACTTTAAACGGCGTCTGGGTATGCGGCGGTGAATCGTCCTGCTCGACAAACATGCCGACGCGACCGGCTACCAACGGATG
GTCGTGCGGGCTCGAGCCTTCGCTATGATTACTCTCAATGCTCCTGGCCTTTGCGAGCGGGCAGGCGTAGACTAGCTGACCTGGGATCAGCGGCGGGAGC
TCGTCGTCATCTGAAAAGTACTCGTCACTCTCTTCGCGAACCTTCGCAGCCGTGCAGAACGCGACGTCGTACGAGTTGTCGCCGTACTCGCGGATGATAG
TCCCGGCGACAAACTGGCGGGATAGCAGACACACGTCCACGGCCACGCCTGCGTGCTTGCACAGTGGCAAGCTCGCATGCACACGGTCTCCAGTCCGGAA
GAGAATCTCCCCCTCTCGTTCGTGCTCACCACCAGATATCGTCGCTTTGTCTTTCGTCACAGCAGCTTCCTTCTTGAAGCTCTCACTTGAAGCAGTAGGC
GCGGTGGATGGCACAAACTCAAAACCCACCCAGTCGCAGTTGGTAAAGAGTGCCTGCACAAGCTGCGGCGTTTCTCGCCCGTGCAGGTGGCCGATCAGCT
GGTTTTTCGTATCGCTCACGTGGGAGAGCACCTGCGACCACCGATTTAGCACCACGTCCAGCGCCGCAGCGTCGGTGTAGGTCAGCAGATCCTTCTCGCC
GCCGCAGAACACGTGCTCAAAGACGTAGCAGAGCAGCTGCGGTGTAAACCGCCAATGCAACTTTGTCGAGCGGCTCATGCGTCGCACCTGGGCCAGCAGC
TCCTGGGTCACGTTGCGGCCGGGAAAGATACTCACCTTGAAGACCTCCCACAGGAACGCCTGGGCGCTGCTTGACAGGTGGGCCTGGCGTGAATGGCCCG
AGCCACTGTGCGACATGGTCTTGGCGTCGAAGGGCATGCCCACGAGACGAAACGTCTCGGCCAGCACGCGCTTCACCCGGTCGGCCCGGTGGACTCCGAC
CAGCTCAAAGTCGACCGTCATGTGCAGCTCGAGGTCCTTATTGTCCTTGTCCCTGAGCACGATAACCTCGTCACTGAAGGACGTGAACTCTGGGTCCTTG
AGGATATCGTTCTGTCCAAACTTGCCACGGAACGACTTCCCCGTAGCCTCCGAGCTGATTAGAACATCAAAGTACGCGACTTTGGACACGTCGTAGGTCC
GTCCAAGCAGCCTCGTTGAGGATTTCGATCCGAATGCTCGGCTCTGCGAGATGAGGTCACCTAGGCGGTGCTTGTTGCCCTGCGCCAGGTCCTCCGAGTG
CGCGTCGAACAACACACGCTGACCTCCGTCGCCATGCGGCTGGAAGACACACGTGTACTGATTCCAGTCAAAGTTCGTCGTCTCTAGCGCCTCGGTATCT
GCTTTCTCCGCGACAACGACGCTCTGAATCTTGAGATCCACCGAGAACTTCGTGTCGAGATGCTTGGCGACGGTCATCTTGGTCGGACTCGAGGCCGCAA
GCTCGCCGGTCACCTCCACAAAATTCTCGTTCCGGATGAGCTCAATGTCGAACCGGAGCTTGCCCAGACGCCCGTCAGCCTCGGGGTCATTGCCCTTGGC
CAGCTTGCTGCCGAGTAGCATTGCGTCGACCTCGACCTTGTTCTTTTGGTTCAAGTGCAGTGCGCGCGACGTCGGATAGCCCTTCGAGTCCGCGTGGACG
AGCATGAGGCCGGTGATAAACCCAGTCTTGTCGCGTTGGAGCTCGACCTTCACAAACCCGAGCGGGATCTCGCCGACGGCATTATCGTCCATGACGCGGA
GCAGCACCGCCTTTTTGTCACTGAGCACGCTGTTCTCCGTCCTGCCGAGCATGAACTCCTGGTTCTGCCACTTTGGGTTGAGCGTCTTGGGCTTCACGTC
GGCCTTCATCAGAGTGTACTCCTCTCGCTCGTTGAGCTCGTGCATCAAGATTATCTTTACGAAAGGGTTTCGCTCCAGGAAAAAGTCCCCGTGGAGTAGC
TTGCGCGCCTCGTGGATTGAGACCTTGAGGAACGAGCGCTCGCGCGTGACCACGCCACTGGGCAACGTCGCAGAGCGCTTGCGAGGGTACACTGCGTCCT
TGAAGAACTTGAGCGGGTTGGACACGAGTGGCTGGAGAATGCTCGGCTTCGTCGCTGCCTCCTTGAGCTCCTCGAGGATCGCGGGTGAGTGCTTGCTGCG
CACGAGCTGACTGATCTGGTGAAGCCGGAGCTGGACGCGGATCTGGCCCAGCTGCATTTTCTGCACCATCTCGTTCTCCGGTGCGAGTGGGTACCACGTG
TCGATCACTCGATGCGGTGAGACCGTCTTGATCGGGATCTTCAGGCAGCCCAGAGGCTTGCGGCCGCTGCATGTGACTGCCATGCGTGTGATGCAATCCT
CCAGGTCGTTTGGCTTGAACACGACATTCGAGTCCGTGCAGCACTCCTCAACCTTCTTGGGGTCCAAGTCACCGTTGGCCGTGCGAAAGTGTTCACGAAG
CATGCCTTCTTCGATGATGATCTCGTTCGAGTGGCGGTACTCAATGTCGTAGAGCAGGAACACATCGCGTAGACTCTTTGGCAGCTTAAGCCACGACGCC
TTGTCCTTGACCTTGTACTTGAGCAGGAGTTCGTCCATGGCCGGCGGGACCTCGTTCGCGTCGTTGCGGTCGTAGGCAGTCTTGACGTGGTACTTGGCGT
CCACGTACGGGGTGCGCACACGCACGACTCGGCCCGAGTAGAGCGCGCCGCTCGTGAAGCTGCGCGCGTTCGTGGGCTTTGGATTCAGGCGCATGCCCTT
GCCAAAGTACGCGAGCACGCTGCCGTTCGGCGCGCCAAACTTCTTCATCTCACTGCGCAGCTTTGCTCGCATCTCGCGCAATTTCTCCTCGTGCTGGCTG
TGTGACGAGTCCAAGTGGTGCTGGAAGACACGGTTCAGCAGCCGCTGGAAGCTGCCCTCAAGGTCGCTTAGCTGGTACTCGGTCTCGAACTCGATGCACT
TCTGGTGCAGCACCTGTTCGTTCAAACGCTTCATGACCACGAGCTGCCCCACCTGCATGTTCATCCTCACCCCGGTCTGGGCGAACGCCATGACCCAGCG
CTGGGCCTCGGCTGACTTGAACTCGAGCACCTTGGCGCCGTTCTTCTTGGTCGTGAGCATCGTCTCGGCCTGCTCGGGTTTCATCGGCACGAGCTTGAGC
GTCCCAGGCTGGCGCAGGAAGATCGTCGCATTCGCGATCTCAAACCACCCGCCCTTGGCATCGATCGTGAGGTTGAACCCGACGTTGCACACGGAGCTGT
TCATATCCACGACCACGAAAGGGGACGAGGACGTCTCACACTCGTACATGTAGATCGTGAGGTTGCTGGGCAGAAAAAGGCAGTACTTCCAGTCGTAGAG
CACGTCTTCGTCGAGCAGGTCCTTGGTCTTCTCGGCCAGCGGCTTGAGCTTCTTGTTCACCGTGGTGAGCATGACGGACGTGGACGTGACCAGGCTCGTG
AGCGCGTTCTGCGTGCCCAGGAAGCCATCGACGTGGGCCGACAGTTTTTTGGAAAACAGTTCCTTGAAAGTAGCTTCAGTCACTTTCTTAGCTGTCCCGG
ATTTCGTAGCTGCGGCTGTAGGGATCGACGTAGGACGAGGCGGCTGGTAGCAGTCGAGCTCGCGCACGAGGTCCAGTGGGAAGAGGCTCTTGTCGCGACT
CTGCTTGCTCGCCCAGAGCTCCACCTCGCGAATGCGGTAGTAGTGGTCCGGCTTGTCCTCGACCATGTAGTGCGATCGATTCGCTTCGGTGAGCGCACCA
CTCGACGTGACGTTCTCAATGTACCCAGCGTCACACAGCGCGCTGAGCCATACAAGGGTGTCCTCGCGGCACCCCGGGGGTTGGGTCGCGTCCGGGTTCT
GCAAGAGCTTGGGGTCTTTCCAGCGCAGCAGACAAGAGTTTTGCTGGGCTGAGTCGTGGCAGTACTTTGTCCACTGGTCTTCCCACAGCACTGGTGGATC
GCGGAGAATCCACGAGATCATCCCTTCACCCGTGAAGCAGCTCGGGTGCAGCAGGACGAGCGCAGTCGTGCGGTCCTGAGTGAAGAATCCGCCGTCCTTC
TGCAGCGCGTGCTGGCGAACAGAACGCAGCTTGACCCAACCATCCCGTGAGAGGTCGGGCGCGGGGTACACCCGTGGGAGATCCGAGCCGGCCAGGTCGA
GCAGCTCCATCTCGAGATGCAGCACGATGTCCTTGCGCGTTTCGACCTTCATCTGATTGATCATGCGGCCGAGCCACTCGCTCTTTGGATCGGCGTTGAT
CGTGTGCACGTGGCGGAACTTGGGCATCTCGATGGTCTTGAGCACTTCAAAGGTCTCGAACAGCTGGATCTCGCGCAGGATGCTCACGATACGCTTCGAG
ATTATCGTGAGCACCGTGTGGAAGGCGTCAATCTGCGCATTCTCGGTTGGCGTGAGCGACAATCGGAGTATCTCGCGACGTTCGATGCGGCTCAGCAGAC
GAGTTGTGATCGTGAGTGACGACGGGTGCGCTTCCAAAGCCTCGCGCCGTTCGAACCACTCGCTCATGCCACACACGGTCGCTCGGCTCTTGGGTTTCTC
AACCAGCTTAGCTGCTGCTTTCTGGCCGGGCTTTGAGAGCGAGATCTCGTGGTTCTTGGCCGCATCCACGCAAGCGACGTGCACGCTGAGAGACCCGACA
AACTTGTAGTACGGGCACTGCTCGGTCGGGATCAGGTTGAGATGCATCAGCTCTTCGCCGTCGTGGAGCGCCGCGAGGTCGATTTTCGCATAGCCCAGCG
ATAGATGCTTGTGCGACGGTACCTCATCCTCGCCCTGGTCCACGACCCGAATCAGAATGCTGGACACATGCACGAGAATCTCAACTCCGTCGTCAATGAG
CTCCTGCTCCGAGGCCGTCGTCTCGACTTCCTCGCCATTATCGTCGTTGTCGCCATCTGACTCGCCGTCTTGCATGTCGCCAAACACGATCGACTTGTTC
TCGAAGTAGTGCATATCGTCCACGTTCTTACTCGCAGCATTGTGGGCGACAGGCAGCTCGTATACGTCACCAGCGCCCCAGTCAAAGCCTTCGATCGTCT
TCCTCGCAATCATCTTGCCGTCTGAGTGCACACTCACAAGGTTTCGTGACTTCTTGGTCGAGACACCCGGGTTCCCGACGAGCGTGACGAGGCATCCGGG
GCGCTTGACCTCCTTGGACAGATCAGACACCGATAGGACTTCCACCTTGAGCGACGAGAGCGAGTGCTTGAGGCTTTTCCAGCGCAGAGTCTCGAATTCC
TCCTTCTGAATTCGCTTCGCCAGCGTCTTCTCGATCGAAGCCGAGAACGCCTGCACGGGCATGAGTAACGCCACGGGAACGGCGCAAAAGTACGTTTCCT
CGGCGCTTGCGTCCTTGGGTTTGTCCACCAGCACGACGTCGGCGCTCCCGTCAGCGCGGATGGCCTTTATCTTGCCCTTGATGTCGATCGAGAAAATGTT
GCGGATGTCCTCGATCGTCTCGATCCTAGTTTCAAAGAGCACGAGGTACCCATCTTTCGGGAACGGCAAGTACCGCTGCACACGTGCAGGGAAGAACCGT
CCGCCGTTTTGGCACGCTCGGAACGCCAGTACCCGCTGGTCGTAGCGGAGCACCTCGAAGCCGTCGTCGTCGACCTCGCCAGAGGGACCCAACTTGTGCA
GCTGGTGTCGCTTGAGGTGCGCCTCCTGCCTCTTATCCTCAAGCAACAGCGACAGTGGCAACGTCAGCTCGCCGGGTAAGTTGCGTGTGTAAACGTGAAG
TGAGAGGTACGAGATCGTCGAGATGTCCTTGAGCTTGCCAAAGACAAAGTTTTGCTCAGGCCAGTGCGGACTGCGCGTCCCGTAGACCGTCAGCCCCTGC
TTCTTTTCGCGATGCTCGAGCTCGCCATTGCCCAAGACCGGAATCACGGTGAAGTACGCGTTTGTGAACGCCGAGTTGTTGAGACGATGGTAGTGGTACT
GGTACTCGCCCGCGTCTCCCAGTGTCTTTGCAGCATTGCGTCGCGGAGCAGAGTGCAACGGTCCGAGCAGATTGCGCGCACTGTGGATGCGCAAGTGGAG
CGTGAAGTGCTCGATCTTGTCCGTGGTCGTGTCGCTAAACATGCCTGGATAGGACAGCGAGAGTTGGAACTTCTCCTTGCGCCACTTGGCCTTGTTGCCG
ATCCTCGTCGCGGTGCGGATCTCCTTGCCGCGCTCTAGCACCTCTGTCACTTCGTCTTCGTATTCTGGGAGATAATCGAGATTCATCGCCGAGGTCAGCT
CATTCGACAGCTGGCTGCCCTGCATATACGGGTCTGACGTGAACGACGAGAACGACAGGAAGCTCAGCAGCTTCTCGGGCGAGTTCTTGGGCACTCGCTG
TAGCATCTCAGCGAGCACCGTGGCGTCGCCGACAACCTCCGTCTTGATACAGATCTCACCGAGATCCTGCGCGTGCTTTTTCATCCACGGCTCGGGCATC
AGCGCGTAGCGCTTTTTCAGAGCTGTCGACGCGATCGACGTCGATGTCGCGGAGGCGTGGCACAAATCACTGAGTGGGATCTGCACTCGACCTAGCGGCG
TACTTCGGCCAAGGTTGTTGTGGTCCTTGACGTGGATCAGGAGCATCCCAGATTCGGCCAGAGGGTGATGCTATCCAACAGTACCACAGCGACACAACTG
ATGAGTATCAGCGCCTTTGATATATCAAAGCAGCGCACATACAACCAGGATAAAGCACAACTTACATGACCGAACATGAAGACCTCGTTGGTCCAGACCG
GGTTGAGCGTTCGCGAGATGATCGCAGTCTTCTTTTTCTCGCTCTCGATCGGCTTGCCCGACTCGCGGTCCGTGATCGTGAGTGTACAGTACGGATCGCT
GTACCCGCCTCTATCGACGCCGCTGAGGCCGTGACCACTAAGCACCTCGACCTTCAGAGACGGTTGGTTGGGGCTGTTCTTGATGGCTTTCTCGGAGCGC
AGCTCGTTCTTCGTGAGCTTCGCTCGAGTCGTCGTCACTTCGGCAATCACACGCTTTGACAGCATCGTGTTGCGTGACTCCGCAGCAGCCGCGTTCAGAG
CCTCGATGCGCTTGCTCTTCTGGGGCGACAGCGGCGCACTTGTCCGCTTGCACTCCTCGACACACACTGCTGGCGCGACTTCAATCACCGCGTACGGGTT
CGAGCCAGCGAGCACGTCTGTCTTCGTACTGTCTGCGTTTACCACGACCTGCACAACAGTCACTTCGAGCACAGCCTGGCCTTCCAGCCCTGCGCGCGCC
TGGAAGCCTTCCTCTGTCAACCTGGTCTCTTGGTGCGCCTTTGGGATCTGCGTGTTGAGTTCGTGGATGCAGCCATTGATGCCGTAGAATCGAGGGTCAC
GCGCAGTGTAATCGTTGACTGCGCACGTGATTCGCGCACCATCGAGCTTGCACGCTGCGTCATGGAGCTCGTACTGGGCATTCTCGAGCTCCAGCTGCTC
GACCGACTGCTTGTGGGTCTTGGCAGCGACCTCCTGGTGGATCTTGAGTCGTCGACTGCGCTCACCTCGGCTCTCACCAAAGAGAGCGAGCTTGAGCTGG
ACCGAGCCCAGGTTCTCTCGAATCGCCATGCCAGCCTCCGGCTGGAGCTCGTACCACACGGCCGCGTTGGACACGGAAATTTCGTCCAAATCGATGACCA
CACAACCTAGCGGGTCATTCTTGCTGTGCCTGTCCCAGTCCATGACGCGCACCTTGAGCTTCGCCGCCTGGTCGATCGACGAGAGCATGCCAAAGATGTG
GTGCTCTTTGTCCCACGTCGGGTTGCGCGTCTTGTACTTAATGCTCGTGGTGAACGCCTCGCCTCGGATGGGTTTGCCGTGGGCGTCCACGAGCGTGAAC
TCGCAGAACGGGTCCGAAGAGTTGTTGAAATCCGCGCTGATGAGTTCTTTCGCCGCCAGCACCGTCAACTCCAAGCGGTTGTCCGAGTGCTCCACGCCTT
CGTTCACGATGCGGCTGCGCGGGCCGAGGGCGCGATGCAGACTCTGGAAAAAACTGACCAGGTTGGGCCCTGTGACGTTCATGACCAAGTGCAGCTCGCC
ATAGTCCTTGAGCATGGCCTTCTCGGACGCTGCATGATGCGGTGACGTCGTCGCTCTCTGCGGTGGCTCGATGCGATACCACGTGTCGATCACCTCGGAC
TGCGCGGTGCTCGCTGGCGACATGTCGAAGCTCGACAGCGGCACACGCACAAAGCCCAGTGACGTGTCTCGAGAGAAGTGGTCGTGGTCCCAGAGGTCGA
ACTGGAGCGCGTCGACGCCGTGCAGATCAACAGCGTTGCCGAGCGTGAACCTCGAGTTCCACTCCGGGCTCAGGTTGCTCGTGACGTAGTCGGTCTTTAC
CTCCTCGCTGCGGATGAGTTCACCGTTCTTACCCACGAGGTTCACGACGCAGTATGGGTCGCTTTTCCCATTGAAATCCGCCGACCGGAGGTTCCTCGCA
CTCTGAACCAGCAGGTGGAGAAGCACGCGCTTGGGCGACTCGGGTCGCTTCATGCTCGCTGGATACGCTGGCGCTGGTCCACGAGTCGGCGACGGCGGCG
GCACGGGAGCGACGTTCTCCAGCGTCCTCGCGGCGTTGAAGATTGCGTCGCTCCACTCATCTTTCTCCAGCTCGCTCTCGGCCTGGAGGTAGAACTTGTC
GGCGGTCGGGAATGCTTTGACGACAAAGCACAGCGCGTAGCCCTCGTCGTTTGTCAGCTGGACCTCCGAGTCGTGACCCAGCGGCACGCGGCGACGCACC
GCCGGCTCCACGGGGCTCAGGCAGTACACCAGCTCGTTCGCGTAGAGCTTAAAGTACCGTCGCTGCCACTTGCGCGCCGCGGGGAAGGCATTGCGACTGC
GTTTCTTGAGAAATCCCTCCTTGAGCACCTGGCGCGCGTCTACCATGGCTCCTTTGGTGCGTTCTCTCTCGTCAGCTTACACCTGAATCTGTATGGCAAT
CTTCTCCGTCTGCTTGTGCTGCGTTGCCATCCACCCAGGCTCAGAGAAATCGGAGAGTGAGATCTTTTTCAAGCATGGGACGCGAAGAGTCGTCGCGCGT
CTGCTCGCTCGCCACTTGGTAATTACGCAAAGTATTTACCACCACCACTGATTGCCTGGATGCCATCGAACTGAAACCACTCCAACATTTTTCTTCTTCT
CTCAGAAGTGATGATGTTCATGAAGCTCACTCACTTTGAGTTCACACTGGTGCTGGCTGAGTGAGGATTTGTGTTGAGACTTGGGTGGAAGACTGGATGG
ACGTCATCTCTTTTTCTTTGGCTGTTGCTGCTTGGGCTTCTGGAAGAAGAGCGGGGGTGGCAGCTCGCGGACAAAGAGACTGCTATCTGGCTCAGTGGGA
CGGTGATGGCGACTTGAACTCTTTCGCGGACCTGCATGTGGGCTGTCATGGTGGACTGAATGGTGCATACGTGGTGAACGAGTCTTGTCTGGCGATGGAC
TCAGCTGATGACTGCTTGAGCAGGCATGTTTCTTCACCGAATCGATGCGAATCGCAGGATACACCAGACAATTTCTCTGTGAAGCTGCTCTCGGAGATGT
CTGAATTCTCTGAGCATCCTCAGACCCGAAGACCGAATCTAGGTCGCATTGAACAGCCATGTCCGCCTTTGAAGCGACAACAGGTTCACCTCCGAGCGTT
GCACTTAGAGCATCAGCACTGGCATTCTTGCTTTGTTCCACTGTCGCCACCGAATTTGATTTCTCAGTCGACTCTCTCTTCTTGCTGTGGGCGGTACCTG
AGTTCTCAATCGAACCGCCAGGCGAGCTGGAATCTTGTACCGACACCTTCGATCGGAGTGACCTTGCCATATCTCCATCATCTGGTACAGGAAGCTCGGT
CTTGCCCACCTGGAGTCCGATGGCGTTCACAATGTGCGGCGCGAGAGTTCGCCCGAGACACGAGAGCGTCGCCGCCCCCGTCGCGACGCCGACCACTCGA
TTGCAGTGGTCCCGCAGCTCCCATATTCCATTGCTGCTCGCCCATTCACACACGCGAAAGCGCATCTCTTGGTTTATCGACGCACCGTGGACTCTACTGT
CTTTAGGAGCGTTGATCAAGCCGACATGGAGCTCGATGGGCACGCTCGCGAAGGCCACGAGCCGCGCTTTCCCGTGCTCCTGCTGCATGACTAACAACGC
GAGAGGGGCGTCGCACTCGCGCTGCAGTTCGAGCGCCAAGTGGTCCGTGTCGGCTTCAAAGAGACACGACTTGCCATGCTGGAGCTTAAGAAGAACGCTT
CCCGAACCGCCGTTAAAGCTTGTCGTGGCTTCAGCTGTGTCAGCGATAGCGTCACCGCCGTCATCATGTCCACCGGTGGATGCCGCCACGGCGTCGAAGA
GCACGATCTCGTACTGTAGCAGCTGGAAGCCGACCAGGAAGCCCGCAACCGCGCCTTCTTGTAGCCGCTTACTGCTGCTGTTGCGCGTCGTCTGGGGCAA
TCGCAGGTCGACGCTGCTGAGGAAGAACTGTAGCGAGAAGAGCAGCTGCTGCTGCCAGTCGTCGCTGGGCTGCTGGTCAAGCGCTGCGGGCGAAGCCGCC
GTCGCGCTCGTGGCCTCATCGAGTGTTGCCATTGCCGACCATGTGAAAGTTACTTTCGCGCCATATTCGTTTCACGCGAGTTAATTAGTGACATTGAAAC
AGCAATTTTGTATGAGTCACTCTTTCAGGGATCGCTTTTGCACACCACTTGACCACCTCACGATCCATTTTTTGGCCATTTTGCTGATGTTCAACATGCC
GACCATGCGCTCGCTACACGCGGCTCTCCGCACCTCCACCCGCGCGCGCTTCTTCAGCGCTGACGCAGCGCACCGCCTCGTACAGCAGCGCGTGCAGGGC
CAGGTGGCGCTGCTGCAGCAGCAGGACGCGACGTCGCTGCCGTCGACGACGCGCGTGATCTTCGTGACCAAGTCGGCCGCTGGCGGCGCGGACCTCCCGG
CCGCGTCGCTGCCGTTCCCAGTCTCCAAGCACGCGCTGCAGGACTTCCACGCCAAGCCGCAGGAGAAACTCTATCTGTACTCGAGCTCGGACGACGACAA
GTACGCCAGCGAGCGCGTGCTCCTCGTTGGACTCGGCGCGGCCGAGAAGGTGGATGAGGACGTGCTGCGCAATGCCACGCACGGCGCACTGAGTGCGCTC
AAGGCCAAGCGCGCCAAGGGCGTCGTGCTGCACGTGCCTGAACTCAAGGACTCCAAGCTCAAGCAGGAGCGTGTCGTCGAACTCTTCTCGCAGGTACGCT
GTCGTATCTCCTATCATTTGGCTGTGATGAGGAACTCTTAGTCTGATTATGTGGTTTGTTGTGGTACTGGTAACCAAATGCAGGCGTCGATCCTCTCGAA
CTACCAGTTCGACAAGTACCTGACTGCCGAGAAGGACGAGAGTGGCGAAGACAAGCTCAAGCTGCCGCTCGAGAAGATCTTCCTGCAGGCTGGTGCGGAA
TTCCAGCAGGTAATGCCTCACTAACGACTGAGCTCGTCGCCTTGCCTGGTGCCTAACGTATGCTGTTTGCTTCAATAACTTAGAACGTGACGGAGCAGAT
CACGGTCGGCGAGGAGACGATCTTTGCGCGCAACCTCGGCAACGAGCGCTCGGACGTGATGGACCCGGCGTTCATGGAGCAAGTGGCGCGCGCGTCGGCC
GACCTGCCCAACATGTCTGTGCGCGTGCTGCAGCGCGACGAGCTCGCTCAAGAAGGCATGAACATGTTCCTGAGCGTCGGCCAGGCGGCCACGTGCCCGC
CGCGCCTTGTGATTCTCGAGTACCGCGGTAACCCGGCCTCGGACGAGAGGATCGCACTGGTCGGCAAGGGTATCACGTTCGACACTGGCGGCCTGAACCT
CAAGCCCAGCGGGTTCATCGAAGACATGCACACCGACATGTGCGGCTCGGCGGCGGTGCTCGGCGCTGTGCGCGCGGCGTCCCGTCTCGGACTCAAGGTG
AACATCGTGTGCGCGCTCGCGATGGCGGAGAACGCGATCGGCTCCGAGGCTGTAAAGCCGCACACGATCGTCAAGTCCCACAAGGTGCGTGGCAAATTGA
ATGATTGCTGTAAGGTGATGTGGCGAGTGGTATTGTAACACTTGCATGTGTATTTCTGTGTGAGCAGGGTATCACGGTGGAGAACAACAACACGGATGCC
GAGGGGCGGCTCGTGCTGGGCGACACGCTCTCGTATGTGCAGCAGCACTACAAGCCGAAGAAGGTGATTGACGTCGCGACGCTCACTGGCGCCTGCATCG
GTACGTGAACCTTCCAAATGTCAACTCTTACCGTGTTATAACCAACTATGTTTGCTTGGACTGTAGTTGCCCTCGGTGAGCACTGCGCTGGCGTCTTCTC
GAACTCGGACGACCTCGCCGCCAAGCTCCAGGAGTCGGGCACGATCTCGTACGAGCGCTGCTGGCGTTTGCCGATCCTCCCGGAGCACTCGGTCGAGCTC
AAGGGCTCGCAGTCGGACTCGCGCAGCACGGGAAAGAGCCGCTACGGCGGCGCTTGCACGGCCGCGGCCTTCCTCAAGCAGTTTATCGACAAGGACGTGG
AGTGGGCCCACATCGACATTGCTGGTGCGTTCCTTACAAGCAAACAAACCTTGTGAACTAGTCGAGGAGAACCTTGGCACTGACCTCAGCTTGTTTGTGT
TTGTTTGTCGACTGCTGCAGGTCCGTCCAACTACAGCGCGCCTCAGTCGTACTTCCCCAAGGGTGCCACGGGCTTTGGCGTCCAGCTGCTCTACACGTAC
CTCAAGAACCATGAGCAGCAGTAGAG