Description :
From Genome Similarity Track
Location :
scaffold_1352:994- 2581
Sequence
1587 bases(100 bases per row)
GACTATCGGGATCATCTGTGGCCCCAGCGAGTGGTCAGGTGGATCGAGGTGAGTTTCCTCATCTAGCCGATGTTCAGTTCGAGTCGATCCGAAAAATAAC
GGGTATCTTTTGGAGGCGAGGTCTTCGGTTCACCACAACAACCAGTAGGCCGAGCACATTGTTACGTTCGACATCTACGAGCGAGACCTCAGTACTCACG
TGTGGTGGTTGCAGGTCCCTACTGCCTAACAAAGGCCAGCACAATCAAAGCCATTAAGGCTCAAGATTCGTCCCTACGAAGGGAAGGAGGGAGAGAACCT
CCACTTCTGGATTCGAGAGGTAGAGCTCGCGATGGACGCGGCTCTTATCTCGATCGAGCAACTGCATGTTGCTTCGCGCTATCAAATCTTAGCGGTTGTG
CTAAGACTTGGGCGTACACACGCGAAGCGACGACGCCGAGTTGCTTTACAACCTGGCCTCAGCTGTGTAAACAGTTTCGACCCGCATTCTTGCCGGTGAA
CTACGAGTATCTCCAGCGTTCACACTGTTGTCAAGAAGGCGCCTCGACCTGCCACGGTGTACCAGTAGACACTGGTACGACCTTCACTCAGTGGCACTCA
CGCATTCACATGATTACGGGACAGGTGATTGCGAGACATGTGATTACGGGACGGTGTCGCATGGGTACAAGATTGTGGATACAAGATGGGCATCGACGTG
GCAGTCTCTGATTGGCTAAGGTAACTCAGTATCCAGTTAGGAATCCAGTAGTGTGTATCCAGGAGAGAATCCAGTAGGCTTAGAGGTAGCAAGCAGTTAG
CGAACTAAGGACCTAAATCAATCACTTTGCATTTCGACATCTACTGCTCAAAGCGTGAACTGTATGAGTACATCCAAGAGATGCGGATGCTTACCGTGTC
TCTGGTAGGGAACCCCAACCTGAACACATTAAGGTGCTAGTGTTCATGGATGGCTTAAGAGTAAGACCGGCCCACACGCAGCTATTCCGCGTGCAGGCTA
GCACAATGGAGGTGGTGGTTCAAATCGCCCTCCAGAAAGAGTACAGTCATCGGCAGGCTCGTACTCCTGCTTCAGTGCGGCAAGGCCACAGTGCACCGAC
GAGCGCGGCTCAAGGGGCTCCTGGAAATGGGGCCAGTACCCATGGAATCGGGTGCGGCCGAGCAGAACTCGATCCGATGCTACGGGTACGGAAAGCTTGG
GTACATGCAACGTGCCAGCCCCGCGGGTGGGGATAGGAAGTATTTTTCCAAACCCAGGGGCTCGAAGGGTGTGTAGCAGAAGCCATGACCTAGGCGCCAG
GATAACGGGAAGGCGGGATTTAACTGGGGAAGATCTAAGCCTTAGTAGAAGACGTGCTGACGGCGCACATCTTGGAGGCTTAGCCCCAGGTACCCTTATT
GCTCTCGAATCGAGAAAGAGCTGCTGCTGGTACACACAAGTGTACGGGGATACGACCATCCCTTCCGAATCCTAATCGATTCAGGCGCGCCGAAGAACTT
CGTGTGCCGACAGTCGGTCAGAATAACGACAAGTTTGTCACCACTCTGCACGAGAGTGAAAGCAAGGGCCAGGACATCCTCGTCAAA