Description :
From Genome Similarity Track
Location :
Scaffold_3842:994- 2368
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_3842-abinit-gene-0.54-nitrophenylphosphatase

Sequence
1374 bases(100 bases per row)
CACGCACGCAGCACGACGCGTACGCGAGCTTGTAGTAGCACAAGTGGCTATGGAACCAACAGTGAGCAATGGTATCCCACGCTATGATCAATATGAAGGG
AGAACGCACCGATCGAGGCCGACGACGACCGCCCGGACGTCCTGGTCCACGGCAAACGGCACGGGGATGTCGCGCACATCACTGTGCTCGAGTCCAAAAG
CCTCGTACCCTTCGGCGAGCAGATCCTCGTTCAACCCCGTCTCCCCTACGACGTAGACCTTGCCGGAGATCCCCTGGTCCTTCATGTATTTGACCGTGGC
CCATGCCGACCTGACAAGAAAAGTATTACTATCTCTTCCTTCTCCGCGTCCCCTCCCATCGCTACTCACGTGACAATGTCGTCGACGACCGCCTGGATGC
CCTGTGATGCTACGAAACACAATAGTAATACTCCCATTAGACTCCACGGCCATTGCATACAGAGTCCCCTCGACACACTACGGTAGGAAGGACCTACCGA
GCTTCTTGACATAGGCGTCGCGGGTCTTGGTCGAGTTGTTGGTCTTATGTATCACCAGACAGAGCCGCATCAGCCCCACCACATTAGACGCCCACGATGC
ACCTACGCACCACGAAGATCACGCGCTTGCCAAGCGAGCGCAGCAGCTCGACCATGTCGCTGGCACCGGCGATCGCGGCGTCGCCGCGCCACAAAACTAA
ACACGAGCGGGGTTCGTTTGCATCAGCCGCGCGACTAGAGAAACGGCAGAAAGCGTATTACTACCGCCATCGCAGTCGAGCAGGAACGCATCGAGTCCGT
CGATCCACGCGGGGAACGCGTCGAGCGCGAGCTTCGGCGGTGCCGACGCCATGGTTCGAATGATGCAAGCGGCCAGCGCTTCCCATTAGTGACATGGATG
TCAGTATCCCTGGAATCAGACTGTCCCTCGTTGGGAATCTCCAACGAGGGACACGTGCCACTTCAACGTCCCAGGCGTCCCTCGATCAAGAGCTCGACGA
TCGATCTTCACGCGACTGAGAAGGAGTTCTACGCGCAGTGGATGCGTCTCGTTGCTGAGCTTCACCAGCAGAGAGATTTCTGAGCCGCGTACGACTGCCA
ATCTGCATCAGCGCTTCGACGTCTTGATCTCCAGAACAATCAGGAGTAACACCGCACCACGCCACCTTGCAAATCCAATGGTAAGGACCAAGTGGGGAAG
GCGATACTCCATGGTTCCGTCAGTGTATCTTTGTGGCGTCGGATCCGCATCTCGGAACGTTACCAGGTTTTCTCTTCGCGCCAGTCAGAAGCAAACCATA
CTACACAGAGCTCAGTCGCACAGCGCAACCCCTCTTCCTGGCTGCTCTGCAACCATCTCTCTCGAGAGAGAAAT