Description :
From Genome Similarity Track
Location :
Scaffold_1418:994- 2071
Transcript NameFunction/comments
Phyag_g10570glucosamine-fructose-6-phosphate aminotransferase [isomerizing], putative
Phyag_g10571hypothetical protein PHYSODRAFT_286451

Sequence
1077 bases(100 bases per row)
GGGTCGGGGCTTCGGTGAACCGATTGCCTATGAAGGTGCGCtgaagatcaaggagatcaCATACCTGCATGCTGAGGGCTACCCTGGTGGCGCCCTGAAA
CACGGACCATTCGCTCTTATCGAAGGCGAGAAGAATGGCAAGTTTGGCGCTACTCCAATCATTCTGatcgcgctggacgacgagcacgcgAGCTTTATGA
AGACTTCTGCTGAGTCTGTGCGTGCCCGTGGCGCTCACACTATCGTCATCACCGACAACCCGGCGATGTGCGAGAACATTGCCGACGAGATCATCCCTAT
TCCGACAAACGGCCCCATGACCGCGCTGCTCGCGACTATACCTCTACAACTTATCGCCTACGAACTTGCCGTGCGCAAGGGCATCAACCCGGACGTGCCG
CGCAACTTAGCCAAGGCTATCACTGTCGACTAATGCAGTACTAGTAGCCATGAACACCCTAAAAGTATAGGTCTATATAtgtttctccttcttttttAAT
TATAGGGTCGGTATTATCAGAATTCTCAGCTTCAGAAATCCAACAGgaagcgacgatggcgagcgcCGCGATGGTTGTGTACTGCTTCgacacgctgcag
tcgcacttcgacggcggcgtcgaGCCCACGCCGCGCTTCGACGTGCAGCAGGAATAGTACGACGCCCATCGTCACTACCTCTTGATTCCATACGAAACCT
TACTTGTGTGCTGTTCAATGTCCAGTCCGCTGTTCGTGACGTGGGAGATCGAGGAGCACGGCGGCACCCACTTGCGTGGCTGCATCGGCACTTTGGCGCC
CACGAGGCTGCACAATCTGCGCGACTTTACCTTCAAGAGCGCTCTGCGCGACCGCCGCTTCGACCCCATCGGgccgcaggagctgcagcgtctgcactgC
TCCGTGTCGCTGCTCATCGACTACGAGGACGCCGAGAGCTACGACGACTGGGAGGTGGGTACGCACGGGATAATCATCGACTTCAGTGACGCACGTGGCA
ACGAGTACAGCGCCACATACCTGCCTCAAGTTGCTCGTGAGCAGAACTGGAATCATGTCGAGACGGTCACGTCGCTC