Description :
From Genome Similarity Track
Location :
Scaffold_14:99374- 101096
Transcript NameFunction/comments
g1157.t1XP_009517793.1 hypothetical protein PHYSODRAFT_358892 [Phytophthora sojae
g1158.t1XP_008896953.1 hypothetical protein PPTG_05199 [Phytophthora parasitica INRA-310

Sequence
1722 bases(100 bases per row)
ATGCATCCGTGTCATACCTTACGACAGACCATAGGAGCTGGATCTACCATGTGCCGCGTTGGTACTGGCACGTGTTCGAGCACGCCAAGCCTGAGGAGCT
GCAAGCAACAGCTACGTGTTCGCCTGTTACCTGGTCGACGATGTTCAAGCAGGCGTGGGAGGCCCACCCGAAGGAACACGATACAATCATGATGTTTGGC
AAGCCGACGAAGATCCCGCGGTTCCAACTGCTGTGCGGGGAGATGCCTAGCTATCGATACTCAGGCAAGACATTTGAAGCACAGAAGAGGTTCCCGCAGG
GTCTGGAACACGCTGTTCAGCACATGCGGCGGATGGTGGAGGACTCGGTCACCCAGCAGACACGACTCTCAGGGGGTCTCGTGAACTGGTACGAGAATGG
AAACCACTACATTGGACCGCACGCGGACGATGAACGTGATATGATGGCGTGCTCTCCTATCGTAGCGCTGTCATTGGGGGCTACTCGACGCTTTGTGCTC
ACAAAGAAGACGTCCAAGAGTGCCCCTCAAGGCGATGGAGCTGTGACACGGTTGGAGTTGCAGATGGAGGACGGAGACCTGACGATCATGGGCGGTACCA
CGCAAAGAACTCACAAGCATGCAGTGCCCAAGATGGCGCGATGCCGTGAGCCAAGGATCAGCATTACTCTGCGCTGCTTCCACTAATGCGAAAGTTGTTC
ATACATATTGATTCGCATAATTCAAACAGACGAAAGCTTTCACTTTGCCTTGTTGCTTGTGACACCACGTGAGTGGAAGCGAAACACGGCGCTCGCAAAT
CGCGGGGCCATGCGCCCGAAGCAGTGCGAGTGAGCAAGAGCCCACGAGATCTTGCGCCAGCGAGCCACCACCAACTCGAGATTTCCGTGTAACCTCTCAC
TGTCTGGTCTAGCCAGTACGTCATCATGTACCAAGAACTGCTGCATGCTTTCCTTAGCCTCCTTTGAATGTTGGAATTGGTCCCAGATCACCGTAGCGTC
AGTGCCCACAGCATCCCCAATCACATGAGGACCGCCCGGATGCAAGTCCAGGAAGTCCGTGACATCATACACCTGCCCTTCAATTGCCAGGCACTTGCGG
CCTTCCGTGATGCCAAGCAACCTCGCTAGCTCTACAGCTCGTGACAAGTGATGTTGGAAGTAAAACTGCCTCCAGCACTCAATGGGGAACACTTGTGCGA
ACCTGTCGCCTGGCTCACAGAAATCTCGCCGGAAGACGCGTCTCCAGAGCGCCTCGGCAGCGTCCCCAATATGGTAGTTCCATGCTCTACACACCAGCGG
ACAAATGACCAGATCTTTTGGCGTCAGAAACAGCAGCAGCTCGTGCAAGACGTCACGTGGCAAATTGACCACGGACGTCCCGGCAGCTCTCGAAGACCCA
TTTTTGAGCCTATTTCGCTGCTTCTGCACTATTCTGGCAACCTGCTGCTGCTCGGCTTCGACGTCGGCCTTCTTACCGAGCTTGTTCTTGTGCTGCAGTA
GCCCAAAGAGCCCCAGGAACAGCAGGAAGCCCGTGATCTCGGACGACGTGAAACGCCGCGAGTCTTCGCCCTTGCGGTACCCAGAAACCAGCGGAGACGC
GGTGGGCGGCGAAGACGGAGAGGAGACGGCCGCTGGACGCGTGAAGAGCTGGTACATCACGCTGAAGACGGCGGTGATCACGATGAACTGGGCCACGCGG
TTGCCCGTGGACACGGCGGCAC