Description :
From Genome Similarity Track
Location :
Scaffold_53:99361- 100515
Transcript NameFunction/comments
Phypa_INRA-310PPTG_16034hypothetical protein
Phypa_INRA-310PPTG_16035phosphatidylinositol-4-phosphate 5-kinase

Sequence
1154 bases(100 bases per row)
GGACGCGGCAACCGCGGTGGCCGTGGTGCTCGTGGCAACGGCCGCACTGGTGGCCGTGGAGGCCGTGCCGCCAACGTCCCGAACGTGACGGACATGAGCG
CCTTCCCCAGCCTCGGCTAAGGGATCGCTCTGGGACCAACCGGGATCGCGCGCCCTTGAGCGCCAGCGACATGATGAGTGAGATCTTCCAAAAGAGGGCT
TCTTGAGGACTGGTTTGGCTATCTCTTTTTCTCCTTTTCCTCCCACGAAAGATCCACCGGATAGGGCCTCTGCGCGGCTGGTGTCTGCCTGACTGTGTGT
ATCTCCTGCTGGCAGCCAGTCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCCTTGGTATGTCTATTATTCAATGCAGCAG
GCTGGGCTTTATGCGAACGAAAAGATCGTTGTTGTCACCCAAGTGCGTTGCCTTCATCCGTTGCTGCGTGCTCAACCACGCGTCTACATACCTCTATAAT
CAAGCTACAGGTACATGTATCTACATCAACAAGCCGTGATACTGATGTAACATCAGTGATGTTGCAGCATCCCGACCTTCAGGTTACGTACTGCGGTCCT
GCACGCACTCATAGACTCTACAGTGTAGACGACCACTAGGATGGCGCAGTTAGTCGGCCGATGAAATAGTGCTTACCGCTAGTTGTAAGTTTTCCTCGCT
TGAACACTCCAACTTCATACGGAGGCCTCGGTTCAGCGATGAGCTCGTCCCCGTCGCCGTTTTCCTCGTCTTCTTCATCGTGTTCCCGACAGAAAATACC
CCGACCGGACGGGAAACCATGAACCCACGTACCGATGTATTTCCTCCCGTCAGGTGAGGACCACGATCCGTAGCCTTGCATCTCGCCCGTATGCCATTCG
CCTTCGTATACTTCACCTGACGCGAACGTCAGTGTACCGATACCGTGTCGCTCACCAGCTTTATACTCGCCAGTGTAGACACTCCCACATTGGAAGCGAT
GCACACCCTGACCGTTCAGCTCACCGCTTGTCCACGTGCCGTGCAGTGAACCTCCCGCCGTCGTAAACACGCCTTTGCCGTGCATCATACCTTGATGCCA
CGTGCCTTCATGGGAGTCTCCACCCACCCACTGGTACTTGCCAAACCCTTCGCG