Description :
From Genome Similarity Track
Location :
Scaffold_6:99343- 109878
Transcript NameFunction/comments
Phyta_totarag458hypothetical protein PHYSODRAFT_468503
Phyta_totarag459hypothetical protein PHYSODRAFT_466642
Phyta_totarag460hypothetical protein

Sequence
10535 bases(100 bases per row)
TGTCCACTTTTGCATTTTACGCAGTATAATACGCATTGCATGCAAATTTGACAGAGCTATCCACAGAAGGTATCCATAGCAACACGTGCTGTTGACTATG
TGCCCCTCCATCCGTGTGAAACAAGGTATGTTCGGACAGAGCTCGGACAGAGCATGGTCAATGCCGAACATCCCGTGCATGGATCTTCAAACGTCGTGGC
AAGATTGATCCTGGCGATGGTGCCTTGGAGGTCTGTTGTCGACGTTCCAAGTGGCTGGATGGCGGCcgtggcgctggcagcaAGGGCCGACTCCAACCGC
AGTGGCGAACTCCAGCGCGACACGCTTCATCTCAGCGCACTGGCTCGCGCAACTTGGACAGCGCGTATGCTGGCGTTCTCgtatcttctccagcattcGG
TCAGCAGTAGTGAGAACCTTGCACTCAAACGCGACTTTTGCCTGTTTCGCCTCGCTAGACTGGGAGTAGCTAGTGGTTGCTGAGAGTTTTGAAGAGGACA
AACAGCGAAATGTTAGAGGGATGAATGGATATCCAGCACAGAATGCAAAGACTCGACCGATTCGCTGCCatctcttcaacttggcgTTCGTCCTGTCCAA
TTCGTGCTGGATATGTTGCATCTGCCGTGTGGTCTGCTctagctgctgtcgtcgacgcACCAAATCGTTCTCCAGCCGGAACGAATGGCTTGAAGTCATA
CGCTGAATCTGGTAGACACGGTCCAGCTCACTCCTCATCTCTCGCAGACGCTCTGGAAGACGCGACGCACTTCTAGGTGGCTCCTTGCGACTGGTGCAAA
ATGTAGCTTCGATGCTGCCATCTCGATTGCTGTGGCTTTGGTGTTCACAACCTCCTTCCGCCCTAGCGCCAATCGACAAATACAATCGAACTGCGCTCTG
GGGACTAGCTCTGCGCCGGCAAACaggacaagctggacgcCTTGCTAGCGCTTGTTGGACACAAGTGTGGTGAAACACGTGGCCGCACACCAGGGCTGCT
AACTCTTCTTCCATATTCTCAAGGCAGATCGCACACGTGTTGGCCACATCTTCACTATTCTCGCCCTTCCTTGGAGGTGAGCAGAAACTTGGATGCTCAT
ACGAAGCAGCCCGATACAACGCCATGCCTCACGAGGAAGAACTTCTGAAGTGAGCAAGTTCCAGTCTACACGGAGTATATTCTGCCATCAATACGATGGG
AGCAGACACCTCTCGCAGATGAACCTGCGTCGTGTCCCGTGCTGGCTGGAATATCTATCGTGGGCTTTCAACATTGGCCGATGGCATCATTCAAGGGATA
TTGTACTTTTTGGGTTGTATGTATACTATCTCTGCGTTCAGGCTTGCAGGCCTGCCTAGATGTGCAACATGGCTGCGATGTAGGACGCGCTGGGGCGTAG
CGATGGATCGTACTGAAGACACGCGGCTGCTAGCTCCCGAACCATCGTGGGGCACTCGGGTGTGAATGTAAACATACCCATGAAGCTtgtgtcgtcgttg
ctgtgggCGCCCAGCAGAGGAGTGGTTCGTCGTCGGTTTTCCTCCAGAGCAACGCTACGGGAACTATGCAGCGTACGAGAGCTGTTAGCGCTGGGCAAAC
TTTCAAGCTGGGTGGTGCGACGCCGCGAGTTATCCAGGTCACTGCCAGCAGTACTCGTTGATACAACCGTGCCGTCGGTGGAAAGAAGAGTACCGTTGTC
CGTATCGAAATCGCCGATGGGTGTACGCATTCTCCACGAACTTCTGATCATTTCATCCGCTGTCTGGCACGTGTCCAGGTGTGCAAGCAGCACTCCGAAC
GCGTACATATCTGAAGATGACCGAGAGGGCTCGCCAATCAAGATTTCAGGAGCGAAAAATGCCTTGGTGGTGGAGTCGCCTCGGCGGTAGTACGACTGGC
AACTGTAAGGTGATGATCCGTCCGTAGGGAGTGCGGCCTGCACTGGGTTCAACTTGCAGCCCTTTTTGGGGTCCACGAACACGCTTCTACCATTGAGTCC
GTCATAAGTGACCATGTGCTGGCTGTGCAGGTACATGAGTCCACGCGCGAtctcagctgctgctttcatcttgaagttcttccagTTGAGCTCCGAGCCA
GAACTCCGGAGATATGCTTCTAGCGTGCCCAGCGTCATGTATTCACACACAGCAGTCATCGCGTGCCGTTCGTCCCAAACAAGTCCAGTAATCGAGAGCA
GCTGGGGGTGACGCATTTGTGAAAGCGTAGGGACCATATCCAGAGCTGCCTCCACATCATCGTCACTGGTCTGAAGTTTCGTAACGAGCACCAAATGCGT
ACGATGCTCTGCCAGGGCGACGGTCACGGGGCCAGAAGTTGACAACTGGTTCAGCATTACCACGTCAGTGGCCGGAATCTCCTTGAACGCAGCCTTGCGC
AGTCCGCCTCCAGTGTTATACTCGTTCAGCGATGCTTCGAGTTCTGTTGTCTGGACTGTACCGTTAGACACACCCATTCGTGCTCGCAGGCTTTTAAGGT
TGACTTTCATTTTGCCGTCACCCGACACAAGCGAATCATGTTGCTCCTTTGCCGCCTTTTGCTTCCACCTCCTCAGGAGCACAACGCCACCTATCACGGC
CAGAACTGTGAAGAACGTAAGCCCTAGAACTACAAACAGCACGAcagagctgctgttgctctcgctAGCTGTGGAGGCAGTGCTCTCTTCCTTGGAACCA
GAGCTGTTGATGCTACCGAGTCCGTCACCGTTTGTGTAACACACACTTTTGTCAGCCCACGATACAGCTTCGTAGCCTGTGGAGCAGCTTCCATTGACTG
TCAGATCGGCTTCGAAAACGGGTAGTTCCTGCAAATACTGGAGCTGCGGGAGAGTGACGTGGGCATCCGAGATGGCGTTGCCTTGTAGATACAAAGCCGA
CAGGTTGCGCATTTCATAAATAATGGTGGGGATGTCAGACAGCTGATTGTCGCGGAGATCTCTGTAAGGAGCAAAATATCGGCGTTAGTATCTCATCGTC
GGGTAAAGTCAATAGATACAAAGTGCACCTACAAGACGGACACCGACGTGAACGCGTGCGAGCCACGGGGATCAAACTGAGTGAGCTTTGCTCGCTTGAT
AATACTACGCAAAACAATAAATAGCATATACAAGTCAGAGCATGTCCACGAGAGAGCAAGAAGCTTAGAACTTACAGTGACTGAAGAGTGTCCGGAAAGA
TGTTCATGAGCATATCGCCGACGTCAACGTCTGAAATTACACTGTAAAAtcaaagcaacaacaagacCGTCAGCTTGTGCTCGCAAAATACCAGAGCTTA
GTCTCAAATCGAAGCACACTCACATTTGCTGAAGTGCTGTACCGCTGCGGAAAGCGTCCGACGAAAATGAGAGCGGGACAGTGATCCGCGAGCTCGCAGT
CGCGCCTACGATCGTCCTGCAAATCACAGCAATACACACAATCACCAACGTCAGATGAGCTGCCACgcgttcaagcagcacctccaccacgttcCACATA
CAAGTTCTGCAAGGTTGATGGCAGCGTAAGGTCGTCAATCTTCTGGAAGACGGCGGTGTCCGCCTTGTCGCTCTGTGGCTGGTCGATATCCAGCGTCCAC
TGCGGCATGCTCCATCCAGCTGGCGTGTCCACTAGACACTGCACCTCGCACTTGCCCGAGGTCACGTTCGTCTTGCACGTAGGCATGTTGGCCGTCGAGC
AACCCCGATAGAAGAAACTACCGTCGTTGTTCGTCTTGCTCCGGTCCTCTGCAGTCGAAGGAGCGTAGTTCACACAAAGTGAGGAGCTGCACGCTCCGTA
GCAGCTACTCGTAAGTGTGCTCCGTTCGGGAGGGACACAGGCGTCGTTCGCAGCGACCACCGTCAACGCCGTCGCCACAAACGCTGCAAGCGTCCTAACG
CTTCGCATTTTGCCAGTTTTCACGCGTTCCTGCTGCCGATTTCGCTGAAAAAACTCTGTGCCGTTGCACCGAAGCTGCGCTTTGAGCCTGCTGGCTGTCT
TGCGTCGCTCTGGACGATCTGATTAACGCGACAACGAGGTCAGACATTATTTTTCTagtgtgcagcagcgactgtAACTGGCCTCCTaccgacaagaagc
tggtggttTTCGTGCGCTCACCACGAGCGAGAGTAGCAGCGAGTGAGGATTGACTTGATCCACGGCTGGAAGGAAGTCTTTGCGGCACACACGCTCGGAC
GTCGACGGTGGGCGAATGGAGCGGCACAGGTGGTGTCGGTCCACGGGCGCAAATGTCCCACTGCGCTGCGGTGGGCGACTTACGTGCATAGACAGGGCGT
AAAGCCAGTGGCTTGAAATTCGTTTCACGGAATTTTGACTTGTGTTCAGTAAACTGCATAACGTTTGAGCCGTTATAAAGCAAGTTCAAGTTTCAGTTTT
TGAGCTTCAGGCACAATGCTGGAGCCTGCACCGtgcgctgttgttgctggaagcCTTCCTGTTGCTCGATCGAAAGTAGCTTTGTTGTCGTCGTGGAGAT
CTTCCGGAGTAGAACCCATGCGTTTCGTGCAGTTGAAGCTCCGAAGCAATGACCTCTGGCCCTCTAGAATATAATACCAAGGATAatattatacatgtac
attttGCTATTAAAACAGCACGTATCGGCGGAAGGTATCAACAGGCTGCTGTTTCTCGAGCAAGGacatctccaccacgtttAGCTCGCTACAGCATGGG
ATCAAACAATCTGTCCTCAGTCTCCGTGGAGGCACGATCACATACAGCTGGACGCCAACGTGCGGCTCCCGAACAAGGGTTTCGCGTGAGTGATGCGGCT
GTCTTTCGttgcactacatgtatcactTGTATCCAGGATTCATAGGAGCCACGGTCACCTCGAGACTGATCAAATGACCTGGTATTAATATTTCGCTGCT
TTGGCCAGGATAGGCGTGCGTCTGTGCAGAATGTACACGTACAATAACAATGCTTTCAGCAGGTGGATCGCCTGCATTCCGCGTCCCACATCGACACTTT
CGTTTCTAAGATGTGTATTCACATCAAATTAGGCCTGCTCTCATTTGGGACCGATTCTAAATTCGGACAGATTCTACTTTTTCGTAACGGTTGTTGATGC
GCGTCACAGCTCCGATTTAGACATGGCTCCGCTATTTTCGTTGCCCTGTATGCAACAGGTGGTGTCCACCCCGCCAGCAGAGTGCGCTAGTAAAGCAGTG
TGTGCCAGCCGTGCGTGTCAACGTTTTGCCAGCCACCATGAGCGCCCGGAGGTTGCGTGAAGCGACCAAGACAACACCTCGGAGTATCGCTGGTGCGTCG
CGATCAATGGACGCTACAACCCACCCACGTATTACTTTGTCTGACTTACAAGTATTCTTGCCATTCAGGAACCCCACGCAAGGCGACTGAGAGCGAGCAC
GAATACCTTCGGAGATGTGTGGACCCGGTCCTAATGCCTCTGATcgagtcgttgctgctctaTCAGCCGGAGAGTGTCTATCACTTCATCCACGACTTCG
TGGATGAGCAAAAGGCCAACCGCTTCACACACCACCCCAGGAGCGTAGGctacgccaagaagctcaccAACCGCCGCAAGATGGCGGATTTTATGTCCAC
CAGCGTCATCCCAGTTATGGATGACCTGGCCAAACAAATTCTACGTGAGAAGCCGAACTCCGTGAAAGGTGAGCTTTGAAGACGATATACACTCACTCCT
AAGCTGATCGCTGTACCCTTGTTCTATTGAAAAGCTTTCATCCGAGACGTGGTAGCTGCACGTATCGTTATCGAGTCTAGTGAAAGTCCAGAGGATCCGT
CacaccaagttgaagccgacGTTCACTTTCGAGTAAATGATCACATCTTGTGTCGGTATAAGGGCCGACCAAGATTCTTTCCCGGCACCATCACTGCCAT
CGACGAGAATGGTACTTTCACGGTCTTGTACGATGACGGAAAGACAGAGAGCAATGTCCACCACATGTGCCTGAAGCTGCATCCAACTCCAGGTGCCAGC
GAtacggcagcagcacagaaGCTGGCAACCGAAGAACTTGAAGACAACCAGGAAATGCCGAAGATCACCCGCACAATGGAGATCGTACTTCTGATCATTG
GTGTCGACGGAGCAGGGAAGTCTACACTTCTATCCACTCTGCAGGGAGATCTGGATAAGGAGCACGTGCCAAGTGCAGGCTTCACATCTGCCACATTCCA
GACTGAGACAGGATCCGCTACATTCTACGACCTTGGCGGTGGCCCAGCGTTTCGCAACGTTTGGAAGGAATATTACGCCGACGTAAGTGCCGTGATTTTG
CTCATGTTTTCTGCTGTATTACATCGATATTAACGTTTGGATGTGCTCAGGTTCATGGTGTTATCTTTGTGGTCGACTCCTCAAGCGAGAATTCGATACT
TCAGGCTGCGAACGTGCTCGAAGAATCGATGGCCAATGAACTTATGATCAACAAACCGTTGCTAATGTATGTAGACGCTGGTTTCAATGTTTACATATTG
CAATGACGCGACTTACTCATGAACTTGTGTGCATCGTGAAGTTTTGCCAACAAACGAGACCACTCCGACCCAGTAGCAGAACAGGAGATGCAGAGCTTGC
TACGTCTAAACAAGTTCCCCAGTTCGAAGGTCGTACCCTGCGTAGCCAAGCCAGCAGTCTACAGTGGTGCTGTAGACGAACGTCTGGAAGCAGGTCTTCA
ATGGCTCTTTGACCAGGTTCACAACGACTTTGACACACTCTACGACCGCGTTCAGCACGATCTTGctctgaagaagaagcttgaCCAGCAACGCCGGGAT
GAGCAACGCGCTCGCGTCTCACGTTGGAAAGAAGAGCGTGAACTCAACCAAATGCGTACGCATGACAAGCAGTGTGTCGAAGAGCAACTCACTTTGAAGG
CTGCCGCAGATAGTCCGGAAGAAGCTGTGATATACTGCTCGAACTGCAGTACGGCACCTGCAGTAACGAAGTGTGCAGCGTCCAAATGGATGCCTGTATG
CGAAAACTGCGCAACAGTTCTAAGAAGTCAGTCCGCATAAGCACGAATTGAAATTCTGGACTATTAAACCACTTCAGCAGCTCTTGGATTTCTAGGGAGC
TCCTGCTCGATACCATCTCCTATCTTcgcttcttgccgcccttcATACCGCGACCACACTGTCCTCcatcctcttcttccgttTTCGACCGCGCACTGCT
CACAATCTTCTCTAcattctccttcttcttgttcttaCGCATCTCCTTGCGTTCGCGACGCTTCTCGGCTGCCTTTTGCTCCTTTTCAAGCCGCACACTT
TCAGCCTCTGCCTTCTTacgcgcagcttcatcatctgcttcctgctgctcagcatcgtcgtccttggcATCGTTCTGTTCCATTTTTGTGGACGGTTCGG
CAGAAGCGTCATTGTCACCATTTGCTTCacgcttggccttgccgaGAGCGATTAGCTCCTCCTGCAATTCTCTATCCATTTCGTCGTCCAAAATGCTGAG
GTCACTAAAATCACCGAGTTCCTCCTCTTTTTCGCGATGCTTTTTCGACGTTAGGTGGTTCTGCAACTGCTTCGTAGACTTGAAGGTCTTACTGCACAAG
TCACAAACAAGCACATCTGCATCCATCTTTTTTCGGAACTtttcgagttcctgctggatGTCCCTGTCAGCAACACGGCTAGTCTCCATGTTGTTATCAG
CCCATAGCTTCTCCTGTTGCTCCTGAAATGCTCGTCGCTCAACATCATACGCCGCCTGCTTCTCGCGTTTCCTCGCCTCTTCCTCAATGCGTCTCTGCTC
CTTTTCCTGCTCTTTTTGCTTCTGGAATGCTCGTACGCGCGGATCCCGACGACACACGAAATCCACGAGCTCCCGCACTTCAGTAGTAAACGCCTTCTTC
GCAGCATCCCGCaacttcttgttctccttctccattgcTCGTCTCACCAATCTCGTGGGTGCATCAGTCGTTTTGTACTCGTCCACCCACGCAaagctgc
gctgcgtcgtGTAACTCTTCCAGTGCTGGTAGAAGTAGTTGACACCGTCCATCGACGTGTTAGCATCTCCGAGCTCCGGTGCAGCTTCGGACCTTgagcc
atcgccaccatcCACATCCAGTCCATCAATCTGTCCACAAAACATTCATTAGCCCTGCAACTACGCAGCATTAAACTGCAGCACAGCGCACCTTGGTGAA
GAGTTCGCCGTACACGGAGTAGAAGTTCTTTTCGTCCGTGCCAAAACCCGAATAGACCGACGCGCTGAAGTACCGGAACAggttgaactcgtcctcgtct
tcctcgtcgtcgttccCGTCTCCGCCGCGCAGAATCTGCTCGCGGTGCTCGTCGTACCATTTCTTCTCGTGCGGGTCGCTCAGCACTTCGTAGGCGTTCT
GGATGGTCTGGAACTGCTCCGTGGCCTCCTCGCTCGAGATGCCGTTCTGATGGTGCTTGTCCGGGTGCCACCGCAGCGCCTGCAGACGGAaggccttctt
gatctccaccgCCGACGCATCGCGCGCAATGCGCAGCACTTCGTAGTGGCAGAGCATGGTTATAGGATGAATGACGCACGCACGGACCAGCAAAAAAGTG
TAAATGTGCATGTATAAAATAAGCATGGACTAAAAAATAGTCCTGTTCTGAGGTCTTCGGCTTGCGTAGACTCACGTGCAGGTAGAGCATGTTGATCATT
GTCTCCCGCCTGTCTTCGTTTTCCTCATTCTTCTGGTTGTCAATAGTCACTTCTGGCGGAATTTGACGTCCAAGTCCACCAATGGCAGCGGATGAATAAC
CCACAGTTCCAAGCCAGACTCGCGCCAAAGGCGACAGGAACGGATAGCGCTTGCGATTATCTCGCCACCACTCGAACGGGTCCGTTATGCGCGTCTTGCG
TCGCTGATGATCGGCCAGATACGTGGATACCTCATCCGCCACGTAGATCCTCGTCTCCTCCATTTCAACGTCGTCGGTCGACCGTGCATCGTCCTCTTGC
AGCAACCTGTTCATCATTCCTTGCGCGGGAGCAGCCTTCCGATACAAGTCAGCGGCATGCCctgccaacgccaacgcgcATAGCTCCTGCTTGTCCTCTC
TGATATGTTCCATCTTGGCGTACCGTGGATCCAGAAGAGAGCACCACAACAACTCTGACAGCAAAGAGTCAAAGTTTGTGCTGATACCTTCCAGAATGTT
TCTttgaagcaccagcagatcCCGACTAATCTCCGTCGCACCGAAGTCCATCGTCAATTGATAGTGCTCGATCAATCCTGCCAACGCGTTTTCTTGGTTC
AATTGCTGCTTGATAACCACCAGGCGGGTCATGAACGGAAGTGTGCGAGCTTTTTCTTTCGTGGTAATTTGCCGAACCTCACGCAGCGTGCGCAATAACA
AAAGCAGAGCTTCCGCTACAAACCACATCTTCGCAGTAGGCTCCGTGATGGTTGGAGTGGATGAAGAGGCAAAAAAAGATTGATCGAGGGTCTCCAGACC
ATCAACTCGGTCAAGAAATCATACACCCCATCCCACGAATTGCAATCGGTTTGCCGAATCTTCAGGCTGGATCACTGCCCAAATATCAGGGAACGCTTGG
CGTTGAGTTCCGTAGCGACTTGACAAATCAtcttgtcgttgttgctcaGAAGCAAGGATAAGTTTTTCATCGagagcccccccccctcatAACATCCTTT
ACCAGCTTGTCCACACCTCCATCTCCTGTATTCAACACAGCCCAGAGAAACGTGGCAGGCTCGAAAGCCGCGTTCAAGTGGTGGCACAGCAGTACCAGGT
ATAGCTGTCGTACTGCGATTGCCAGATCTCCGCAGAGAGCGAGAAATGCTCCACCTCCTTTCCCACCCACAGCATGGTTCAAACCGCCACTCCGCCGCCT
TGTGCTCCACAATACGAAAGATAGTATCTCGGTTGGGCAACTCAACCAATCCTCCCGAAAGGCACCTGATGAGCGCAATAAAGCTAGACTCGACCACAGT
CGACCGCCGCTCTGCCACACACACACCGAATCAGCAGGTCCATAGCCTTCGGGTCTCCGGAGTAAAGACTTGCTAGCGCATCCgttcgcttcttcttggc
cacaGGTTGACGCGAACTGTTGCTGGTGTCTCTGCTCTCCATTGATCCCCCTCCGTCCGTCAAGGACTCGAACGACGAGAGCTTCGCCGCTCCACTGAtg
gttgttgctgcctgctccccttctcctccgtctctGTCTGCGCGCCAAACGTCTCCAGCTCTCGCGGGTGCTTAGTTATCATGTGGTTGCGCACCAAAGC
GCTGGATCCTTCCTGAAGGGAAAAGATGCGTTGCATCGTAGACAATAGgtgtccacggcgtcgtcacTGCTCCAACTCGCCAGTctaggggggggggcgg
cCGGGAGGCACAACCAGCTTGATGAACTGTCAGTACTCGGGGCGCCGGATGCGCGGACACGTGAAGAGCGTCAGCTCGCCGTGCTTGAAGGCGCTGGTAC
CAAATTTGCAAATCAAAAGAGTGAGTCGCCAAATA