Description :
From Genome Similarity Track
Location :
Scaffold_27:9934- 16379
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G009780Protein of unknown function
Pytul_DAOMBR144PYU1_G009779Similar to POD-1: Elicitin-like protein 1 (Pythium oligandrum)

Sequence
6445 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAGAATGCGTGTTTTTACACTAGTGGACCTTTGTTTGCGTG
ACGGATTGAATGTTTATAATGCATCCAATCAGTGGCATCTCGAATGGCGTCTTTTTACACCTGTTGACCTTTGTTAATATCACCCGCTGCATGTTCTTTA
ATACATCCAATTGAAGCTGTATGTTGTCAATGCATAAGATGTTATAAATTAGTACATTCAAATGGTTTAATTTAGTATACATAAAACTATAATAAACAAG
AGTTAACCTTAAGTTATTATATCTGATAACCTCAGTACTTACTCCTGTTATATTCTCGGTCAAAACATGAACTAACCTAAACCAGTGTATCAAAAAATGA
ATGGACACCAATTACACGAGACCAAATGCTTTTCGTTTCTAAAACTCTTGGCAATATGCTTTTCAACCACGGGGAATTCGGTAGTAACCATTTGAAAAAC
TTTGGCTGGTTAGTTTTTTCAATATGTGACATATTTTCGGTTTTTGCAGAATACCTTGAAAACTATAATTTCAACGAATTTGGCGTTTTCATCATGATGC
TGTCCATCGTTCAAAACATTCCCCCCAGAACTTTCTACGAAATTTGTGTGGCTAGTTTCCAAATGGGACAGCATCTAAACCCTCACCAAATCGATCTTGT
AAAAAGTCTGCTTTATAAAACTGACGTAAAAACATAACCTTTTGTCTTCCTGTTTTTACGAGTCTGTTTCAACAGGTCTCTGTTTTAACAGTACTTGCCA
ACACTGGATACGCAGCTTCAATTAAATTACTCCTTTGGTCAAGCATTAAACTGGGACCGAACGAAGTGAGACAGCCCCACTAGTATGCAAACTCAAACGA
AATCTCTCCAACACGCATTGTGCACCTCGTGATCATTCATTAAAAACACACACACAGAAACGACCCAGCAGAAACGGTTAACCCACAAGGAATTAATCCA
ATACAAGAGAAACTATCCAAACTAAACTGACTGATCTGCATTTCCCATGACTGTCACTGCAGTATCGCTTCGTTCGCTTCCATTTGTCCCATGCACATAT
TGTTTTCTACGGGTAAATATAACAGCAAAATGTATCCAAAGAGATGGCTCTTTAGATTGTCTCCGCCTTCATGCTCTTAAGCCTTCGTAGGCGCCGGAGT
GTCAGGCTTCGCAGTCACTGGGCATGGCGACGGAGTGTCAGGCTTCACAGTGATTGGGCATGGCGACGGAGTGTCAGGCTTCACAGTGATTGGGCATGGC
GACGGAGTGTCAGGCTTCACAGTGATTGGGCATGGCGACGGAGTGTCAGGCTTCACAGTGATTGGGCATGGAGTAGTAGTCACCGGACTTGGAGTATCAG
GCTTCGACGTGATCGGGCATGGCGTGTCAGGCTTCGACGTGATCGGGCATGGCGTGTCAGGCTTCGACGTGATCGGGCATGGCGTGTCAGGCTTCGACGT
GATCGGGCATGGCGTGTCAGGCTTCGACGTGATCGGGCATGGCGTGTCAGGCTTCGACGTGATCGGGCACGGCGTGTCAGGCTTCGACGTGATCGGGCAT
GGCGTGTCAGGCTTCGCAGTCACTGGGCACGGCGTCGAACCAGTGGCAGGCTTCAGGCAGCCAACAGACGGGAATACACATCCCCATGTGTTGCCGTTCA
CGATTTCACACACGGCGTCTTCTTTGGCGACACAAGCCTTTCCGTCGTACGATGGAAGGTAAGGGTGGCAGTCAGCAATAGCAGCATCGCCCTTCAGAGG
GCACGCTTTACCCGCTGGCGACGCGCCCGCGCCCGAGCACATGGCACCACGCGAGGCTGGTGAGTTGTACGTAGCATCTCGGCAGACTGAGACCGGGAGG
TCCTTCAGGCCAGCCACGGCAGTGACGGCCACAGCGGCCAACACAAGCGAAACTCCAAACGTCTTCATACTTCCTCGATTGACCCGGGAAGTAATGCGCG
ATTACGACGGCAAAATTGGAAGTGAGGAGAGATGATAAGGTTTTTTCGGCTGCGTGCCAGCGAGCGTGCACACGAGGCCTGCCTGTCACGGGCGAGAAGG
ACGAACGATCGATCCCTCCTGCACCCAACTTAATTCCTTTCTGCCCCATCTGTCTGCTTTCTGCTTTCTGTTGCTGCCCTACAGTTGTACCTCCTTCCGC
TTCTTAGCCTCCTCCCTCCCTCCCACCTCCCTCCCTCCCTCCATCCCGCCGTGATTCGATGCTTTTGGCGCCAGAGAAAGCGCGCGACGTGCCATTCTTC
CGCCTCACCTCGCAAAATTGCGCAAAGAAAGGACAGAATAGATGACGAAGGTCTCACTTACACAATATTAGGGTTAGGAGACCAAGTCCCACTTGACTTT
TGGGTAAGTGGGTGGGTGGGCCACACCAGCACTGTGCTGCTGGTTCGTACTGTTGGCCCGTTGATTTGTGGGTTTGCACGACCCACATCGATCCATCCAA
CCATGTGGTCTACACTGAACACGTCCACCATGGACTCCACTGTCCCGCCGATTGAAGGCGTAAGTTGAGGAACGCCACTTCAACTTCGCAACGCTGATCA
CGCTGCGGAGTATTTTTAGAATGGCACCAATTTTTCATCAACAATAAGTTGGTCTCACTCGGGTCCCGCTTTCGTACATTCAACCGCCACGCTCCAACAC
GCTTCCCCATCTTGTGAACTGCTGTTGTTTTTGTCTGGGGAAAGAAGACTGCAGTGGTGGAGCCAAGACGCAGTTGTAGTGCTCCTGTGACGATGAGACA
GCGCGTAGCCTATTTGTTGTGTGTTTGTGTATCAATTGGGAGCATTCGTTGCTGCCTTTCGGCTTGCGACCTTTCACGGCTCCATGATCCCTTCTTCACC
TTTTTGTGTGTCAGATGTCAAGTGCACTCTGAGGCTACAAATCGTGTGAGGCGAGTACTGTACAGAAAAAAAGATGTGTACAGCTTGCTTTGCTTGCTCC
TTTAGGGTTAAGAATTCTGTATAACTTATTCGATGCTGCCTTCAGCATGATGTATCAGCTTGGGTACCTGGCAACACTGGCAAAGTACCAGTGTACATAC
AACCAGAAGAAATATCCGCGCAAATATCCACTTGGTGTACAAATATTTATGTGGATAAGGACAGATCAGAAAGCACGTTCTATGCAGACATCGAGTACTG
TGCCTCGTTTATGCATGATGTTAGAGTTAACTGGGTCACGCACAGGATGCGTGAAAGACACTCGAGACCACGCACGACAAAGCCTTCTATTTTAAAACAT
TGCCCCTTCTTTCACAGCCATCATCTGCAACCCACCACGTACTGTCGCCAGTATGACTTCTTTTACTTCACCCGTGACAGCATCAACAACCCTTCGCTCT
CGGACACTTGATTGCAATCCTCTTCCACAACATCCCCAACTTGGAACCCGCCAATCTCATTCTCCAATTTGCCTTCTCAGCGACAAATCCAGTCTCCCAC
CACCACAATGAAGTTCTTCTTTGCCATCGCCGCCGCCCTTGTGGCCGTCACCAACGCCGCGAACTGCGACCTCACCAAGCTTCTCCCTCTGACGACCGAC
ACGAACGTGAAGGCGTGCAGCGAGGCTACCGGTTTCACTCCTCCAATCCTCCCAGCGAAGGAGAAGTGGCCATCGCTTTGCGCCAACTCGGACTGCCAGA
CCGCGCTCTCCAAGCTCAAGGCTCTCGGTCTCGGTGACTGCACTGCTCTCGGCGTCGCCCTTGAGTCTGGTTTGATCACCCCGATCGAGACCTTCTGCAA
GAGTTCGACGCCAGCGCCAGCGACGACTGCACCAGCTGCGGGCACCCCAACGACGACTGCGCCAGCTGCGGGCACCCCAACGACGACTGCGCCAGCCGCG
GGCACCCCAAGCGCCACTCCAAGCGCTACCACCGTCAAGCCAGCCTGCTAGATGGAGTCACACTCTATCCACGGATGAAGATGACGTGTGATATTTGATT
TTGTTCAATCCGTCCAAAAATGTGTCGATGAATTGAACTGTGTTTGGATTAGAGTCAAGCGTTCGCGTGTGACTCGCATAAAAAAATAAAGGATATATGC
CTTGACGTTGTGACTTCCATTCTGGTATAGTGATTTGCTTCTGTGAGGTTTATTACACTCGTCGTTTTGGAGTAGCTCGCATTACTTGGCGAATGAGCGA
TACAATCGTCCGCGACACCGAGTGCTTGCACTTCATGGCACTGTGCAAAATCTGCAATTGGAAGAGAGGAAATCAATCTATTTGCTACTAACCCTCCGCC
AGTGGCGGACCACCACCACGTTATGTAGAATGGAGTGGGCATGTTGGAACGCACCAAGATGAGTGGTATTGGACAGAACTAGGGCGGCAAAGCAAACCAA
GATCATAATCAGCATTAAAGGTCGATGACACGCAGTGATCAATGCGTACATGCAATACATGCATGCGTGCATATCATTAGATTGCAACTGCAACAGTATC
CAATGGCGTTAAATGTTCAATGCTGAATAAAAGATTCTTCAGCGCTGCTTCTCCATTGTGACGGATCCGCAACCTAGTATTGTAGCTTTGCACTAGCTCA
ATGCGGTGTGCCAGAAACACAAAAACATTGTATGTGCGCACGCCAGCGAACTTTCTTCGTAGCTAGCGACGACAAGGCTCCATGTCGGTGATCATCGCAC
ACACCTCGCAAAGCTCCACGCATGATTTTCTAGCGTCCAAAGCAGCCATCCAACGGCTGTTGTTAGATCAGTATAAATTATTCATTTCTAGAGATATTTC
CTGCTTTAATTAATAAGTGGAATAATATCCATCATTATTTTGAGACCAATCGCCTGCCGTCAACGTGTGATGGGCACGCAATCTCGTCGAAGCACTTTCT
CGTTACGACTTCAAGGTAAAAACAGTCCAAGCTTCTTAAACAACTTCAAGTTCGAAAAGAATGATGACTTGCATGCACAACACCAGCTCGCCTCCTTAAG
GGGTGATCAACAGTTCCGACTCAACTGCAAAGGGAGTTGTTGAGTCCAAATTGCACCAAATTGGTCTGTGATGCCTGTCAAAGAAAATCCAGCTCGTGGG
AATGTCTGATCTCTTGCTCACTCATCTTCTGTGCCCAAGCCTTTCTCGAAGGTGAATCATTCCCTGCTCAACACAGTTGCGGCGCATTGCTTTCTGCTGA
GGTTCAGGGTACCAAGCATTAGCACTCGTCTTGGTTTTGAAAACCAAATTTCAAATCTAAGTGTGTCACTATATTCGAAGGCAAGCATCATCAGTTCGTG
AGAAAGCTTGGTTAGTGAGTGCACGATGGATTTTGAAAAATAAATGGCGTCATACTGTCTATAAGCGAGCCATATTGTATTTGCACCAAGAGATGAGAAC
TTCGGTATATTCGAATGTGTTTGAGTCATAACCTTACACTTCACGAGTAGTTCTCAGTGACTCCAAGTGAAAATGCTATAATGAATCGTACGCTGCTGAA
TAGCGGCTCAACTAAAAGCTAGGGTGTTCGTAGCGCCACTATAGAAGGTGTCACCTACTTCAATCGCGACCAGCGCACAAGTGAATCTCCAAGAGTTTCG
ACCATGAACGCAGGTTCAAATTCAACTAACTGAGACAGCAGGCCGGCGTCACAAATCGAGCTGATGAATGGCAAGGCGTGAGGCTCTGACTTCCAATTTA
TCCGCCCTGCTGCCACTGCTTGCCCATCATGGAATTAATAGGCGTCAGTCACAGTGCAACAGCACAATGCCTGCACTCTCTTCATGATTTTGTTGTGAAC
TTTGAACATTGCTCTCCGAAAGGCTCCAAGGAAGCTCTCGTTGAACGGGAACACGGTGTACAGTAGTAGGTATCTGTTGCATAGCTGACTTTTGTTCAGA
GCACAGTGTAGTGCTTCTGGAACTTCTACGAAGGGCTCTATCGGA