Description :
From Genome Similarity Track
Location :
Scaffold_90:99325- 100627
Sequence
1302 bases(100 bases per row)
GCACGCAATAAAGCGCGCAGCAGCTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCCCCTGTGTGTCGA
TATCGCATACCGCACCGTGAGCTGGCGGCGGCAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGCTCTTTAGCGTCGCGACCAGACGTTCTCGGCG
CTCAGTCGACAGCTCAGGATCAGCAACATTAGGCGCAATGTAGTCAATCGTCGTGTTGATCTCTTCGGTCAGATCCGGCAGGAATGCCAGCTCCTTCGCG
TAGTCGTCCAAGCCAATGTTGTTAGCTGGGTGTTCGTAGAAATCATTTCTCGTAACCTCCGTTGCTTCATTTCCTTCGGTTGTTAACACTCGAGCAACCG
AGATGTATGTTCCGTCCAACGTCGCTACGGATTCTTCCCTTGACTCAACATTGGCATCCGCTTTGATTTCAACAGTCGGTACTTGGTCCATCTCCTTCCC
ATCCTGGTTTCCCATCTCTGGGCCATCTGCCGAGTCGTCGTTCGCAATATTGAATGCGCGGGCCACCGACATATTGGGTTGGTGACTTTTGTTCAGCTCC
TCGTTCTGCCGCTGTCTCGACAGTTCGGCATTCGCACCAATCTTGCAGTGAATACTCGGTGCCGTACTCAACACCTTCAGCGCGATGCCTGCATCCTCTG
GATCAACCACCGACGTCTCGTTCGCAGATTTGGTGACACACAAGGCCGGGACAGCTTCATCAAAACAGGTGACTCCATCTAATCCAGCGCTGTTACCTGT
CGCTTCCGTAGCCACCCCTGACTGGACAGTAACACTCGTTGGCGTAGACACCACGTTTACCGGCCTCAGTAGTTCGTGTGTACGCACTACCGAGGCTTCG
TTCGCGTTATTGCTTCCGCCATGGGTTGTCGTGTACGTGTCCAAAGGTTCTTCGGAAGGCTGACCGTCGGCCGGATTCCCGGCTGTCACCCCGGACGCCA
GACAGGCTTCCACTCGTTCGCGTTCTTCCAGGATCAGTGCCCAGCGTTCTGCACACGTCAGCCGATCACTAGAGTCCGCTAGTGTGTCTTCCAAAGGTCG
TGCTAGCACCCCACTGGGTTCTGGATAGCTTGGTCGATCAACTGCCGAAGGCTGAGTTGCAAGCCATTGCTCGTAGATTTCATATTCATGCTGAAAGAGC
TCGCGGTCTCTGCAACCTTCGTAGGCCAACACTTGCCAGTCTTGGTACTTCTTTGACTCCAGACGCACATAGCCGTCACCTCGTCGCAAATCCCCATCTG
GA