Description :
From Genome Similarity Track
Location :
Scaffold_57:99318- 100926
Transcript NameFunction/comments
Phyca_LT1534553891epidermal retinol dehydrogenase 2

Sequence
1608 bases(100 bases per row)
tccaacctagatttagaacaacctagaaagagtgatggtcgtgcttcaactacgtcttactcttccttgatagcgtgcttacgtgtctgcttgaagctct
tcatggcctgcgatgtcttggtaatgcggatgaaccagtccacgaaccacatgggcataatagtagccacaaactccatgacgctcaaaatggacggcac
cagtacgcgccactggttcctgcgtacagctttcacgatctcatccgccacgaactcgggagttagccatctcgtgaacggaggaggcttgacgccctcg
aacatgcctgtcttgatgaagctcggacatacaatggttgtgtgcacaccgaagagccccatagcgtgcagttcctgtctgagactgagcatgaggccaa
ttgcagcagatttactggccccgtagtccaccatacctggtgatccgaaaatccctgctgcactagccaccgagacgatgtgacccttgttgcgcttgct
catcattggcaggaaggccctgatagtccagaaatgtgacgtgacattcacagccatcgtacgctcaatcatggtgtcagaggactcgagcagggggcgc
ccaccgacgataccagcgttgttgactaagatatccaccgcctcgaactccttcagcacctcttggccaatggcgtagaccttctctctgtccgtgatat
ccacttggtagaactttgccttcccaccggcagcttcgatttcctgcaccaattcacgacccaaatccgagtgcaagtcccaaatgacgaccacagcgcc
taatgcagcgaaccgaagcgctacgagacgtccaagtcccatggcaccaccggtgatgacgacgacgtcgcccttgacggacttctgcggccagatccaa
ctgaacatgacgcgacaacttgaagaatgaaagggaatgcgaggagctccttttgagtggtacaagtgattattgatgtcgattctgccgtgatcaattt
gacgcatacttagatcaaaatgtacgtccgtgaatgattgcatctgattcaccaggtcactaaacagtttctttctccttgttcaccaccacaactcggt
ctttggagcgtgtgttgttcgaagctgatgcagatctgctggcgtctcactgaatccgtgttggcaattcacgattgagctcaatcatagccagcagtaa
gacgctaagtgcgctaacgtgttgactgtgaatacgcgcttgaacatggcgtctaaattcactagtagtgcatggcgtctaagttcactacatgtagtag
cgcctcccaccaaacgattcctggattgttaacaagcaaaccgacagagccaaactgcgaatcctttccggtaaactttctccctgtcagccacgtccac
cgcgtagaaatgacgctcgcccctgcgtcattgaaaatgaccgtgatctcctgaacgtctttgaggccgttggtgacgttggatgccagcgatacttgca
gagcctctagaatcctatcacttcaacttgatgtattattacaggaagcaggttttacccaataaacaacatagttttatttcattggtagaaatcccac
ttgctatt