Description :
From Genome Similarity Track
Location :
Scaffold_320:993- 3845
Sequence
2852 bases(100 bases per row)
GAGTTTAACTTATCTTCGCTTCTGGACGAAGCTGTTCTGGAGGACACAAAAGCGGCACTAAGTACACGCAGTGGATCGTCAATATTGAAAAATCCTCATG
ATCCCTTTCATCCCACAGTCAAGATATTTCAAGATATGGTGTGCCACAACCCACCGTCTGCTTTACTTCCAGATAGAGGTTTTCGTCATGAAATTGACTT
AGTTCCTGGGACCAAATATTGTGTCATACGACAGTGCACTTTACCATAGGAGTAATGTGATGTCATTGATGGCTTCTTCCGTGTCAAGCACGAGGCAGAA
ATGGTACACGAGAGTAAATCTCCACATCGACACCGACGTTTTGTGTCAAAACGCCGAACGGCAAGTGGCGTGTTGTGTCTTCTTATAAAAATCTTAATAC
GGTCGCTATTCCGGCACATACACCCATTACTCGGAATACAGTTCTTCAAAACAACATTGTTGGTTGTAATATGTATAGTGCTCTCGACTTAGTAGGTGGG
TACTATCAACTGCTCATGCGAGCGAGTGGTATCCCACTTACAGCAGTGAGCACTCCGAGTGGTATGTTATGGAATGGCTGATGATGCCCAAAGGGCTGCC
TAATGCTCCGGCTACATTTAATCGTCTGGTGACATAACTTTTCTGCCCACATCGGGATCACGCACATACGTACTTTGATGAAATTTTTGTCCATAGTCGT
GCCGAACAAGGTCGGTCAGATGTTGACAATCACATCGGTCATTTGCGAGCCGTGCTTGAGTGTATGCGCACGAATAAATTGTACGCCAACGCGTATAAAG
GCCTTTTTGGTGCAAAAAGATTCCTTTTCTAGGACATTTTATTGGTAAGCGCGGCCTCAGAGCGGATCCCGCTAAGGTCAAGGTTACCGTTGACTGGCTG
AGTCGTACGAATCAAAAAGACTTACGCAAGTGGCTTGCCCTTGTCAATACCATACACAAATATAGCGAAAATTACGCTGATATGGCTCGGCCATTAACTA
ATCTCCTTAAAAAGGACTCAGATTGGCGCTGGGATGACACCCATGCTGACGCATTTCGGGCAACAAAAGAAAGTCTCCCCCAAGCTCCCATTTTGGCGTT
GCCAAATCCTGAGCACCCTTTAGTGTTGTCTGCGATGCATCCGAATTTGCCATAGGAAGCCCCCTGTTACAAGTAGATGCTGCAGGCCGCGAGTGCGTTA
TCGCATTTAAAATTTGTCAGCTGAAAGCTGCTGAAAAGAACTATCCAGATCATGACAAAGAGTTACTTGCCATGAATTATACTCTCGTCAAATTTAGAGT
TCATCTGCTTGGATCCAATCCGTTCGTCGTCTATACGGATCATGCGTCACCACGCACGTTGACACAGTTGCCTTACTTCCCTCAGAGAATGGCTCGGTTA
CTTTTCTTCTTTGCGGAATAAACTTCGAAGTGAAGTACAAACCGAGCAAACAAAATGTATTGGCAGATGCCCTCTCTCGCCGACCTGATTATGAGCATGC
TCATGTTACGACTCTGTCGTCTCCTATTGGGGATTTAATCCATATGGCATATCCACGGAATTCCCAATGTGTGACATTGTTTCGTGCTCTTGGCTGTGAC
GAGTACACAGACTCGGACACCTCCTTGTCGACACGGTTGCGTGCCAGCCTACATCGATATTCCATCGATCGTGGTCTCTTGTGCTATCGCACGGATGTAA
CGGATGTTCCTCGCGTCGTCGTGCGTTACGATAAGGACTTAAAGTACCGAATCCTCTTTAAGGCACATGATACTGCTCTGAGTGGGCATTTGGGCCGGGA
AAAGACTTGTGGCTCTGTGAGCCAACACTACTGGTGACTCAAACTCTACAAATGAGTGAGCACATACGTGCGTACATACGAAACGTGCCAGCGAGTGAAA
CCCTTGGCACATTCGGCTGCGCCGCTCGCTAGTTTGCCTGTGCCCATGGGGTGTTGGGAGTCCATCAGCATGGATTTTGTATTTGGCCTTCCCAAAGACT
GTGACGGCAATACAGGGACTGTGGTATTTGTTGACCGTTTGAGCAACATGGCTCACTTAGCCTCTGTGCCGGACTCCATCGATGGTAAAGGTAAAATTAT
GCTGTTTATTGATCTTTTTATCAACAGGGGTTGGGGTTGCCGCTGGCAATCATCTCTGATCGCGAACCTCGCTTTACGGGAAAGTTATGGACTTCCATCT
GCAATGCGCTTGGCACGCGATTGGACATGTCTACAGCGGATCATCCGCAGACTGATGGTCAAAATGAGCGCGTTAATAGCATCATTGGCGATGTCCTCGC
AGTGTTTGTGCTGAGTCGCCAAAGAATTGGAGCTCGATGCTCCGTGTCATTGATTTTGCGTTGGACAACACTGTCCATGCCTCGACCGGCTTTACTCAAT
ACTATATTAGCCACCCGCACCCGCGCGTTCTGCTCAAGTTACCACTAAGTGGTTCTGGGGTTGGTGGGGGGGCGTTTGCTGACAAGTTTGCTGATATCAG
CCATACCACGATGCAGAAACAAGTGAGCGAGTTTCTCGCGACACACATTAGAGTCTCACGACATGTGCGTGATGCAATGGCTGATAGCCAAGATAAACAA
AAGAACAAGCTGATGCAAAAGGCAGAGGATATATTGACTTTTATGAAGTTTGTGACCAAGTCTTACTAAATGCTGAAAACAAACCTACAAATCTAGTGCC
TGCTGTCTTCAAGACAAATTTGCGTCCGCGCTTCATTGGGCCGTTCACGGTCATTGCTAAGAAAGGCCTTGCCTATACACTCTGTCTTTCACGCAAGCTG
CGCACACACCCAGTGTTTTACTTTGTCTTGCTTAAGCCATATCACGATCCTC