Description :
From Genome Similarity Track
Location :
Scaffold_1170:993- 2345
Transcript NameFunction/comments
g16494.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum
g16495.t1hypothetical protein

Sequence
1352 bases(100 bases per row)
GGGACCTTCGGTGCTGGGCAGGCGATCGTACATCGACGATATCCTGATCACCGCTGACACCTGGGACACGATCTGCGAGAAGGTCGAGGCTTGACGCTTG
CGAGCGATGGAACCTGTCGATCAGCGTGGTCAAGAGTTTCTGGGGACATCGGAAGGTAGAGTACTTGGGTCATCGGGTATCGGCCGAAGGCTTGGAAGCC
AATCCGAAAGATCTGGAATCGCTGGAGAAGCTGCCGTTTCCGAAGACGTTGCGATCGATGCAGTCCTTCTTAGGAAGCCTGAATTATTACAGTCGCTTCA
TTGAAGACTTCGCCGTTTACGCCGCGATCTTATACGAACTGCGAGAAGTGGACTTCTACGAGATGCACCACGGGAAGCATGAGGACCGAGCACCGGAGTC
CAACGATCGGTGGACTAGAGCGAGGACGGCGTTCGACCTACTGAAGGCCAAGCTTGCGACCACCCCGATTTTGCGACACTTCGATTCCGATCGCCAGCCT
GTGATCGTGGTCTACGCCAACAAGTGGGCTATTTCAGCTGCGTTGGTTCAGGAACATGATGGCATGTATTGGCCTGTGATCTTCACCAGTCGTACGCTGA
AGTCGAACGAATTGAATTACGGCATAGTGGACAAGGAAGTTTTGGCGCTCCTCCGGATCTTGGACGTGTGTTACACACTCCTGACCAACCGATCGATTAA
GGTGCTGTCGAGGTATTCGACGCTCGCCTGGTTGCTGAATGCGTCGGGTTTCAAGGGACGATTGGGACGATGGGCAGCTCTGTTGTCCGAGTGGACCTTG
GAAATCCGGAAGTGCTTGAAAGGAGAGGACGAAATCCTGGGCGCGATCGCCGCCAGCATTACACCCCGAGCGGAAGTGGACGAGGCCTTCATCGCGATTG
CACCAGTGAAAGAGCCCAGACGAACGATCGTGATGGCCCCGCCGACGGTAGAGCTGGATGAAGAGTTGCTCGTCGTCAGTTTTGATGGGTCAGCACGCGT
CAAGCGGAGCGCCGGAGCGTATAGTGCAATTGTTTGGAAGCTCCCGGAGTGGTCGATCACATCTGCCGCGTCCGAATTCGCCGACGACCTGACTGTCAAC
GAAGCCGAATATCGCGGACTTCTGCTAGGCTTCAAATTACTGTCCGATCAGAACAGGGGGCGAGTTGTGATCTGCGGAGATGCCAATCTGATCATCCGAC
AGATGCGTGGTGAAATCGATTGCAAGGCACCGGGTCTCCAGATACTACGTCAGAAAGCGATGGATCAAGTGAAAGCCTGGCCGAAACACGAATTCCTCCA
TGTGAAGCGCGATTGGAATCAGAGCGCCGATCGGTTGGCAAGTGCGGCACTG