Description :
From Genome Similarity Track
Location :
Scaffold_133:99248- 102746
Sequence
3498 bases(100 bases per row)
TCGCGTTTTTCCCACTCGTATAGCATGCTCACATCGCATTCTTGTTGCGTGCTTGCTCTTGAGTCCACCATCCAGTCTTGGTCTGTTAGGTCTCCAGCGA
CCAGCCCCGCCAGCGCCCACCATGTGTTCTCACCTCTGTCTTCCTTATTTGGACCATTTTGCGCGATGTGCCCCACTGTGCTGCAGATCATGCAGGTTCT
CGTCTCGGTATACCGTTAGTTGGCGGCTGCGGCGAATCTGACTGGCTTCACTGATCTTCGTTCGTTGAACCGTACGTTTGCGCCCATTGCGTTATTTCAA
GCGCGTGTACCACATAATCTGTTCTCTTCTTGTCATATTGGCTCGCCAGCACAGGTCTAAACTCAGGGCTCGCGTGCAACAACAGGATTTCAGGTATCAG
TGACGATGACGCTCCTGTAGCGTTTCGCATCGCTATAAGGTACAGGTAGTGCGAGTGCCATGTCTTTCCACTCCTCTTCTTCGTCCTAAAGAATTCCGTC
ACTTGCGCACTTGCAAAGCTTCTGTAGAACGCTGACCCCATCTCTTCAAGCGCGTAACGAAGTGGTGGCTCAATCTTCCATCATTCATCTCGAAGTCCAT
TAAAGAACTCTTCTGCCTTCCCACGGAGGCATCCTCCCAGTTTGCTTATCTTTAACTTTTCTGCCCATCGATATCCACAAGCTTGCTGCGCCATTTTGAT
CTCGTCTCGGAAGCCCCGTGCCCATTGCATGAAACCTGATCCCGAACCATTATGTAGTTCGTTTCCGGCAAACACTCTCATGTTGATCTTAGCATCCTTG
GCAGGTGGGATCCTTGTCCCCCCTTCGCTTCCCAATACCTTAGCTTCGTCTCGAACAGCACTTGCCCGCGGGACTTCATTTGCTAGTGCTGAGTTGGCTG
CTATTAAACTTTCTGGCTCCTCTTTTACTGTTAGCCTTACAGCCGCTTCTGACCTGCCGCGCGCATAGCGTGCTCCTCCGCTTCTCGCACTCTTTGTTCG
ATCTGTGCGACTGATATTTGCGCTTGTCTCCACGCCTCTCCAGCCTCGGCCTGAGCTTACTGTACTCGGCAGGCTTCCTCACTTAACTCTGCTTCTCGTT
GGCGTTGCGTTTCTTCGACTCTTCTGGCTTCTTCGCCCAACGCTTGTTCTCTGTGGTGTTGGGCTTCTCTCTCTTCAAGCACTTCCTGCTTGCTTCTTGC
GATGCTCTTCTCCTTATCTCTCACGGCTCGTAGTTGCTCCTCCTGCCGTCTGACTAGTTGCTCTCGTTCAGACAGCAGGCTTGCCTGCAGATTCGCGGCT
TTCTGCGCCTGAAGCTCCGCGTGGAATCTCAATGCCTCACATTGCTGTTTCTGCAGCTGAGCTTCCCCCTGAAGCTGCCCATGTGCCTTCGCATACGCCT
CGTGGTGTTCAGCTTGCTGTTGAGCGTGAAGTGCTGCCGCGCGCATTGCCTCTCGCGCAGCCACATAATCTTCGTAGTGCTGCTGATGTTCCTATCTCAG
CGCACATCTTTAAGTCCGTACGATTGCGTCGTAGACTCGTGACTCGGTCCCGAAGATGTTCCGTAAGTCATCGGCGTCCATGGGTCTTGGTGACACCGTC
CCTACCTTTTGTGGCAAAACAGCCTCAGGTGCTCTCCACGGGCCGGCATATCTTCCGGTCTAAAGGTAAGATCTATCGGGTAGGGTAAGGTGAGTCTCTG
CACCTCCAGTTCTTCCACCCTGTACATCAGTGCAGCTTGCTGCTCCATCATGATGACCAACTCCGGCCGAAGTCCCTACCCACTGTTGCTGCTCGAGATT
TCAGAGGCCGACCGAATGGCTCCTCGCTGTCTTGCCATCGAAGCAGTCATTTCCTTCGTTGGATGGCGTTTCCATGCGCTCAAGCTCCCTATTCCATTGG
GATCATAACCTGTTGACAAAGGACCTGAGGTAAGAGGGGGGCTTTCGCTGTAGATATTATTTTTCTTACTGATTTATTATCTTGTTAGATCCTACACGTA
CCTAATCAGGTACGCAGCTGTCTCCTGCGTACCTGATTAGGTACGCGCAGCTGTCTCCACATCAAATTAGGTATCTTCTCGACATGTTGGCCGCGTATCA
TCCTAGCTCTCTTTCCAACACACCCTACGTGTGTTAACGATCGCGATTTTGTAGACTTTAAGGGACATCACATACAAATAACTGCTTTGGCGACTGCGAC
AAATTATATCGTACACATTGGCATACAAGTTTAAGTGTAACATAGTTGTATCATTCGACAAATATCAGCAGCATATACCGTTCGAAACACGATGAAAATG
GCAACTAGTCACAAGAATGGCAACAACAAGCCACGACTTGCTGGTATATATTCTCTCTGTACAGTGCATACCAGACAAGGGTGAATGGCCTGTATGCTTC
ACGATATCGAGCACGTTACCACTCAAGGTTGCGGACGTTACTACGCGCAAAACCTAGGCTAAGGATATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAAGAAGAAAGCTCTAGAAACAAATCATA
CTCATTCCATTCTTGACCAAATTGTACCATCCAGTTGCTTGGAGGCGCAGTGAATCATATCAGTTATTTCTCTATCTGAATCCTTCTGCAAGCATCTTAT
TCAAGAAAACACCCAGTAGGGCGTGCTGGTCGCAAATTTGCTTAAGCCACATGAGTAATATTGATTAATTTACCTTGAACAATATTGTTAGCATCGACAG
ATAAACTCATTTTCAAATGATTTTCGTTGGTATGATAAAAAGTCAATAATTATTTGATTAAAAATTGATGATTTTGAGGTAAGAAACACGTATTTCATTT
CTAAAGTTCATAAAAAAAAGTAGGAGGAAAATGTAAATGAGAACACCCCATACCTTTCATAAAACAAACTATGGAATAAAGAAAAGTGAAATTAGTTACA
TCTTCATAGATTTTATATTAAACCCTATAAGCCTAGTTAAGATTACAACGATTTCAATTAGTAAGGGTAAGGTTGGTATACATCCGAATTATACTGGTAT
GTTGTTGATGATGACTTCATTTTATTAAGGCCAAAGACATGAGCAAAACACTCCAACTTGACCTCAGTTATAATTTTAGCACTTTAACTCAAGCTTGTTC
CAGTAAGACCTTCCAACCCTCATCAAAATGTATTACTTGGGTCACTTTTGACGAACTAGTATACAATATAGTCATAGAAAAGATTTTCCTTCGTAACAGA
CACCCCCTTAATGAGTGGTTGCACATTTTTTGTATGAAAAGAAAGCAAACAAAAGGGAAAATGTACATTTGCCTTCTTTTTGTTTCACCGGTGGTGACAC
GAGACTCTACCGTGGAAGCCGGTAGCAGAATGGATGGCTACCGTGAAAGTCTCTCAAGCCATTATACTTAGATATCACGAAGATAAGGAAATTGGGTG