Description :
From Genome Similarity Track
Location :
Scaffold_433:9921- 14209
Transcript NameFunction/comments
Phyke_g9420hypothetical protein PHYSODRAFT_354853
Phyke_g9421hypothetical protein

Sequence
4288 bases(100 bases per row)
CtactgctgaagaagttgcgcAGCTTCGGCAATTTCCCGCACTGCTTTCGCTACGGAAACTAGGCGTTCGCTATGGTCGTTGGGCGATAGTGTGTCCGTC
AGCGCTCCCATTTTCTGCAAACACAACATGAAGTGGACAGCAGACATAGTTAGCCCTATTACATCAACCAGGCCGTCAAGACAGGGAGCGGTGATAGGTT
TGGTTTGTCGGTTTGTTGACATGCAAAGATCGGACTTGTGGTCCATTTGATCGTGCCTCAAAAACTCCCCTCGCCCACATCACAATAGTCCCGGTATAAT
CCGCTGGCGCATCTCGGGTGCAGCAGGGCTAGCCCCAGGTCAGAAAAAATGCGGATGTTCCACCTTATAAAGCGCTGCGAGGGTCTGTCGCCGGAGAGCA
TTCACCTCTGCGTCGTCCGTAGAGCCATTGGATACTGCATTCTCGACCTTGCGTTTTATTGCTGGAGCATCCATCAATTGAATTCGGTCAGTTGATTGCG
TTGTATAATAATGTGCCCACTGACGCAGTCGACAACAGTACCAGGtccgtgtgctgctgttgacgctCGTAAGGTTTTTGCCTTTTCAAGTTCCTGCATC
TCCTTTGCCCGTTTTGCCTGCTCTTCAAGAcggaactgctgctcgatATGGGCCTTTCGCTCCTCCTCAAGTCGCGCTTCGGCTTCATCCAgagcaacag
cttcttcgtcctcttgttgctgcctctTAGCCTCTTCCTCAGTGACCACGTATTGGTCACATCTCACACAGTACACCTAGAACACTCCAGATTGTTAGCT
CAACGTTAATGTCTACTCCGGCCTTCAATGCTCGTCCCACCTTGCCCTGCCTGCTGCGCATCAACGGCGTGTAGCAATCCTCAACGGGGCAGCTATTGCC
CAACATTGTCCAGCCCTACAACATACAAAAcaaggcaacaacaacaaaatagTGCACAATACACAGACGCTTCAGTATTACAACAGGCTATTAGTTGTGA
AAGCGAACACTCCACGCACTTGCAGCATCTTCTGGCCCAGAAGCTTGCTGGCTTCATCGCGTGAGCGCTTCACAGGAGTAGCTGTCTGTAACATGCACAT
ATATGGAGACAAGGGAAACGTCAACGCAGAGCGTAGAAGGCGGCATACGCATCGATAGCGTGGGGCCAACCGTGTCCATCGTCTTGATCGCTGCTGTGAC
GTTTATTGTAGCTGCTCGTTCTATTCGATCCGTTTTCAAGTGATATTTATTTAAAAGATGAAATTACAGCTTCTATGTCATTCATATGTATCTGTTATAG
AGGGGTATACGAATTGAAAGTATAttactttttttttttggcgGGAACAGAAATCAATAGACAAACATGGCTGAAGACGCTTCAGGGACTGTGCGGGTGT
GTTTAACGCGCTGTCCGCTGCCTCCAGCCGAAGAGCGTGTGCACTCGATGCCCTGTCGGATCCACTTTGACGGAAAAGCTGCCGTCAAGACGTACTTCCA
TCCGGAGACTGGCGttgccaacagcaacagcacagaCCACGGCACTGGTTCGGAGCAGCGAGAGGAAGATACCGCCACAGCTAAAGAGGAggcgactgca
gcagatgacgacggagcaaTACGAGCTGAGTTCCGAGGCATTCAATTGCAGGGCCAGAAGTTGCAATTGGCGCCCATGGGCTTCACTGGTGCGTGACGTC
GTGCAGTGTCAGGAAGGAGATTGGCTCATGGTTTGGTTGGTGGCTGTGACTTGCAGGCTTGGTGTTGGAAGACAGTGGCATGAGGCACCCGACCGATGAA
GGTAGAATCTGGGAGGTGGAggatcacttcaacatgatcACGTGGTGGTAGGTACAGATACAATGCAGGACGCGTCGTTGGAGAACTGACCTTGCTGTTT
GCCTACCGTAGGGATGTACCCAACCACACAACGAGCGAGTCGCAACAATTGCctttggtgctgcagcagtggcgagACCTCGCCTCCGCGGTACGTGCGA
TGCCTGCATTAAGACTAAGGTTTTTAGCAGCAAAAGGGTGTAGACTTTAAGATACGATGCTCATCACTGTGTTCTTTGATTCAGATCCATGACTAGTCAC
TGACAGCCACCCGATCATTAGCGCTCCATCTTACTTTACTCCAGTCCCAACACGATCATCAAAAATACCCATTACAGACGCTCGTTTGGCTGCATTTTCG
GCTCAATGCTCGAAAATCTAGACCATTGACCCCCTTGGTGGCATCAAAGCAGTGGAGATCGAGCACAACGAGCAGGACCTGCGGAGTCGACAATGCAGGG
GTCGTTGCCCTTTGTCGTACGGTATCGATCAAAAAAGTCGAAGCAGCCCTTGAACTTACACTATTCTTGATGTGGTCGTAAGTCTCAAGTTATCTCCCTT
TATTGACTGTCTTTATTAATCTATAAATACCTATTTCTCAAGATCAGTGTCCTTTACAGTCAGGTTGGTTCCCTCCTTTGACTGTCAATCCACAGTTTTC
TCGCGTGACGCTTGTTGTGTCGATGTTATCATTCGAAGAAACCAGGCCTGTCGCTATACATTTCTCCAGATCTCAAGCCAACGCAGGCAGGAATGGCCGT
CGTTGCcgcctcttcttcgtgcatGGCGATAGCGGCGCGTGACGCGGCCCTGCTGGCGTTGCGTCCCTACGAGGCTCGCGCTACGTCTCACTCTGCGATC
GCGAGGGCCAAAACCAGAGCTTTGGGGATGACGGCGCTCCGCTCGCGCTTAGGCGACGCTGTGGCCAAGTTGGTGGTATTTCCAGTCGTTGGGGTGAGTC
TCTGCGGCGCTGTGACGCTCCTCCTGACTCTGCAGTGtgtggagacgctgcagagacggcggcagcagctccagtggcgCGCTCACCTCTGGGCCGCGCT
CTTGGCGTTTCTCTTGGCTTTCCTGCCTTCTAATAGACTAAAGGCGGCGGTAACGCCTCGTGCTGAAGACCAGAAGAGTCAAGAAGGACTAGAGAAAGGG
ACAAGTACTTTATTGTGCAGTGGGAAacgagaaggacaaggaacaagtggtggagaagaagaagagagcTATGAGGCCAGACCGTTAAAGAGACAGAGAT
CGGGGCCTGGGAAGAGTGGAGATGATTCAGAGAAGGAGAAGTctgaggagaaggaggagaaggaggaggaggaagaagagagtgaagctgcgaagatgaa
gactgcGAGTCAGAAGACACCAGTGAAGAGGCGTGTGTTTATCTGGGATCTGGATGAGACGCTCGTGCTCTTTGCGTCGCTGTATACAGGGACCTTTGCA
CAAACTCATGGCAAAGAGGTGGCACCTGGTGTGGCGCTCGGTGAGCAAATGATGACCTTCTTACTAGCTATGTTGGAGAGACATTTCTTCTTTAGTGACC
TGCATGATGCAGATGTGGATCATATCGCTCGTGTGGCTGCTAGATCCCATGAGAGTGAAATTGTTGGAGGGAATTTacctcagcagcaggagaaacgAGA
GAGATACGAGAGGATCCGTGAGATCTACGAACGTCGTGGGCATGTGGATTTCTTGCATGACACAGATAGCCAATGGTTTGCAATCCGTAGCGCACTAGTA
GCGGGTATTGACTCTTTCTCCACGGGATGGTTACAAGAAGCACGACAGGTACTGGAGCTCATTACGGAGCCTGTACAGACTCTTTGTGCGACAACGGTGC
CGTCTGGCAATCGTAAACTCGAGACGTCAGTTGGACCGGAACGAGTTAGTGAAGTCGATCGAAACCCTTCAAACAGCAATACCAACGATggggaggagga
ggatggcgATGGGGGTGAAGCGGTGGAGAATGTGAACGTGCTGGTTACAAACACGCAGTTGATCCCAGCGCTGTGCAAGTGCCTAATTTACCAATTGGAT
TCATTTTTCCCCATTGACCGAGTGTACAGCTCGGCAAAGATCCACAAGTACCGGTGCTTCGAGACTATCGTGGCCAAGTACGAGGCACCAGGTGTAAAGT
TCGTGGCTATCGGTGATGGActcgaggaagagcaggtgAGTATCGCTCTCGGACTTGAGTTCCACAAGATCCGGTCGCTCGTCGATCTCAAACGTCTGCG
TTacgatctgcagctcgtgcaaaacaacagcagtgccTCCGGATCATCACCTGCGGTAGTTGGTTCCTCATCTGTCGGAACGATGCATGTAGTCTCCTCA
GTCGGTCAAACTGCTGTGGTTTGAGGCATTAGTTAATGTGTTGTTCTTTGCATGTTATGCGCAGTGTTATAGCAAACATTATTTATTC