Description :
From Genome Similarity Track
Location :
Scaffold_274:992- 6762
Sequence
5770 bases(100 bases per row)
TCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGGGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCATTT
CTTCGACTAGCGGGGTTGGGTTTAGATACAGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGATAGCGG
ATCTCGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGCGGACTTGGGGGGGGGATAGACAGGTTTTCCTTCTAGATCCAGATACACCTCTTTTTCCGTCG
AGAGAGTTCCTCCCATAACTCCATCGATCCGCGGATCTTGTTTCCAATCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCA
ATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATTAGCAAAATC
TGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGT
GTACTCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAGCTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAG
CAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGACCGT
AGGGTTGCCTTGCGGATGTGTCCCTTGCCTTTGCGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCTCTAGGGTAT
AACCGACCAAGTAGTAAATTCGGTTAACCCGTCGGATCTGCACGTGTATGGGAAAGCTTACTAGGTTGTAGGAACTGGCCAATGTATTATCCAGTTATCA
CTACCAACACTAGATTCGCAATTCCCAACCTTCTCCGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGTTATGGCGC
AAATGAGGTTCTGTATTGATATTTAAGACTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTC
TCTTCTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGTCACCCTATTATGGGTACACTCATCCG
GATCCAGGTCGCTTGGATCCACTTCACTGTAAGTTTGCACTCGTCGTCGATCTGAGCTCTCCCATCATCCAACATCATCTCGCAACCGTCTGTGATCTCC
ATTGTCCCACGAAAGTTCGAGATCCACTGTATCCATCATCCCTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATCCGAACTCGG
AAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCTTCAGAGGGCACCGACCATCCTTCCTTCATAG
GATCCACACTCGATCCACTCTTGTATAGTATATCCCATATCCATCTTAGTTAATCCAGGTAAGGGTGGATCCGAGGTAAGTCTTGGGTGGATCTTGCCTT
CTCGTACGTCGCACATATCAGATCCATCGTCATTCCACACGGGGTGCACCTCGCCATGGCTAATCCACCACAGGCAACTTGCATCCGTGCCAGCCAACCC
AAATCCTCTCTAATCACTTGAAATTGTCACTGATTCGGGTAGTGACTCCGCGTCAGGCCCATTCTCTTATTTCTGAAAAAGCACTTCACCACAATCGCCT
CCTGTACGTTGTCGGCGCTGCACAACAGCGTTCACGGCGTGCATTACCAGCATCCACAACCGCTTTCTCCCTTTCGCGACACATGTCTCCCGCCAAGCGT
ACCGGCAAATCGTCGGGCAAGGCCCCATCCACTACCCCTCCGGTCAGTCCGTCTTCTATGTCGCCCACCGATCTGCGGGTTCTAGCCCAGGCTCTTTCCG
ATCAGGTGCAACCGCTGACGGCGGAGCTCCAGACGGCTCAAGATGCCCAAGACCAAGCTGTGTCCCTACACGCTACCCAACTTCAGACCTTGCGGGCCCA
AGTCCATGACCAGGCTATGGAGATCCAGGGATGGGAGCACCGTGCGGCCTCTCGGTCGCAGGACCTGCGACTCCTGTTGGCTGATCAGGCGGTCGAGATC
CGCGACCTGACCGGACGGCTGGATCGCGCCTCCCGTCAACGAGACGTTATGCGAGATGACAACGACCATCTCCTTAGGGAGATGGCACTCGCCGGATCTG
AGATCCACCAACTCCAATCCCGGATCCACGACCTCGAGCGGGATCTGGAGGATTCCCAGACTGCTAGGGCAGCAAAGGGATGTGAGCTTGGACCGTCTCC
GTGACGAGTTGCGTATGACCCAAGAGGAAGTGGTGACCAACGACTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNACAGGGCTTAGCAAGCCCGCGTACCCTGCGCTGTACGTGTGATAGTTGTTGGCCAAGCCCAACCACTTTCGAAG
ATCCTTCTGGTATCGGGGCGTTGGCCACGCAGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGGTCGCCCGG
TACGTTAAGGCATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGA
TGTGTCTTGACTGCATCTTTGGGCTTCCCGCCGGCGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGAAGGTACATCTTGCTCC
GATTCCCGTCACTGTTACGGGCGAACAAACCTTGCGGTTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCGGGAGACGATTGTCTCGGACCGAGA
CCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTTCCTTTACTGGGAGCTCGTCTGCAGATGTCCACAGCGGACCATCCGCAGACAGACGGTCAGACA
TAGCGCGTCAATCGAGTGCTCGAGGACACTCTACGCAGCGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTTA
GCAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTC
TATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGAATACC
AAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATAT
TTAAGGTGGGGGACTTAGTGTTGCTAGATACGAGGAACCTACATCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACC
ATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTTTACGTTGGACGTCTTAAGCGGTAC
TTTGATCCGCAGGGGGTTGCTGACTCGCATATTCACCTTGCCCCAGCTCCTCGAAGCGAGGGCCGGTCACAGACGTCGACGAGGGCGTCGGAGCAGGCAC
CCAAGCCTCGGTCGGAACGGCAAGGATGCGGTCAAGACCGTACGCCGGAGGGGCTTCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTAC
GCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGCTGGATCATGCGAAAGGCCTCGT
CCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAACAGGTCCAGGCGGCCCGCAAGACGAGCGAGCCCGCC
CTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCTCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCC
TGTGTCGGACCCGCCGTCGGAGCACTCGGACGAGAGGGGCTTTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCCCTGCTTGACCGGAATGGA
GAAGTCCACTTCCACGTGGAACGGATCCTCCAGGAGCAACGGCGGCGCGGTAAGCGACAGCTCCTCGTGAAGTGAAGGGGTTATGCCCACTCCGAGAACT
CGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGCCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTTCCGTGGGTGAATACT
TGAGAGACTCCACCCAAGCCCAGAACATGTCCTCACAAGAATCCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGACC
GCCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGGAGTCCGTAAGAGGGATGCGGTGTGGCGCGAGAAGCACATACCGAGCCGCCTCCGAATTGTCAACA
AACAACAGTTCCTTCTGAACAAGGGTACGCTAGTAAGCACCCCTAGAGGTGTGGCCGCCAACAAGGCCACCAGGAGCGACGAGAAACTCCAGGAAGAGGT
CAGCCCCAGAGCTCTCCTCGGGAGGCCAGTACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGACCCCCCCCCACGCCAACGCTG
GGCAGCTTGGAAGTCCTCCTGCTGCTGGTCGAGGCCATTCGTGATCTCCCGGGGCTCCGAAATAGCACCCTCCTCCTCTTCCTCCTCCTTCTCATCCTCT
TCATTAGAGGAGTCGAAGAGGCCCCGATGAGAGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAG