Description :
From Genome Similarity Track
Location :
Scaffold_1675:992- 2346
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1675-fgenesh-gene-0.0Tubulin-specific chaperone C

Sequence
1354 bases(100 bases per row)
TGGACAAACAAGGGTCGTCTAAAGACGTGGACAAACAGTCCGTTCTGGACTTTGACGAGTTGGTCTTTGCCAACAAGCAGCACGAGGTGATCGTGATTGA
CGGTGGTAGCTTTGGCGGTCAGGATGCGAACAAACGGCGAGATTTGAACTTCTCGCACCTGACTGACTGCACCATCTTCGTTTGCATCGAGACGTCGGCA
ATTCGAGGCGACGCGCTGAAGAACTGCACTATCTACACTGGACCGATCTACGGCAGCCTGTGGCTCGAAGACTGCCATTCGTGCGAGTTCTTCGTAGCGT
GTCGACAGCTCCGCGTGCACCACTCCGCCAACACGGCGTTTCACCTTCGGATCAACAGCCATCCGATCATTGAAGACTGCCACCAGATGCGGTTCGGTCC
GTACCGGCTGCAGTTCGCGGGACTGAAGGAACAGCTCGAAGCCGTTGGTCTGCAGAAGGACTCTGGTTTATGGGCCAAGGTGAACGACTTCAAGTGGCAC
AAGGCTCAGCAGTCTCCGAACTGGAGCTTGTGCGACCCGAAGGTGGCACTGCGCGGGATTCCGATGCAGCTGGCTCAGCGGTTGTCATACGAGTGAGTCC
ATTAGCAGAAGTGCGCGGCAGTACACTGTGGCCACCAATTCGAACATATGAGCAACAGCAACACGACAGCATTGGAAGCCGCCTCAAACTTGTTCGTTGT
CCTCTCTGTCAAGCTAAGCGCGGTCCGAGTTCAAGACGACTTGTCTAAACCCCACATTCTCTGTTTGAGCATGAGATGGCATTGAAGATTGCGCACCAGC
AACTGACTCGTTGTTTGTGAGAGCTGGATAGGTGTGGAAAGAGTGCACGAAAAGAGCAAACCGAGTTCAAATTCACAAACAACCGCGTGCAATACACCGA
ACCTTCATCTCGCGACCACTTCCACATGTTCGATCTAATCAACCGGCAGCATGCCGAACGCCGCCACGTTTCGCATTGTGTACGGAAACGCTGCAGTCGA
ATTGGCACCCCGGAGTAGCACATCTCCTGTCTGCGGCTTGGTCTACTTGAAGAAGCCGCCCTTGTGCTTGTGGTGCTTGTGCTTGTGGTGTCCGTACCCG
TAGCCGCCGCCATACCCGCCGTACCCGTAGCCTCCGTACCCGTGCTTGCCACCCTTGAACTTGCCGCCCTTGAACTTGCCAGGCTTGAACTTGCCGTGCT
TCATCTTGCCGTGGTACGCCACCACACCGGGCTGCGCCACGTACACGGGCTGCGCTGGGTATCCTGGCGCTGCGTACCCTGGCTGGTGCGGCGGTGGGTA
TGCGGGGTATCCCGGCTGCGGCTGAGGCGGGTATGGCGCCGCATACCCTGGCTG