Description :
From Genome Similarity Track
Location :
Scaffold_5:99196- 104161
Transcript NameFunction/comments
Hyaar_Emoy2800972hypothetical protein
Hyaar_Emoy2800973microsomal Glutathione S-transferase
Hyaar_Emoy2800974hypothetical protein

Sequence
4965 bases(100 bases per row)
CTTCTTGTAAGCGTACTGTGTGCCCTTGCAAAAGCAGACCATGGGCACGTCGATCTCTGCCTTCACACGGTTCGCAATCTGGGCCATGTACGGGAACACG
AATTCATAAAAGTGGTCCTGGGTCAGCGCCTCGGCTCCAACGGTCTCAAAAACCTGAAGCGCCTGTGCACCGGCACGCTGTTGCGCCAATAGAAAGTTCA
CGCACACATCCGTGATGCTTTGTAGTAGCTTATGAGCTGCTTTCGGGTGCTGATATAAGAAAGTCTTGAGCAGCGCCTTGGTGCGACTGCCACTGCCCTC
AATCATGTAGCACATGAGTGTAAGAGGGGCACCCACAAACCCAATCAGCGGCACTTCGCCATTAATCTTCTGTCGAGCCAAGTTAAGTGCGTCCAGCATG
TAGCCGAGCTTGTCTTCAATATTAGGGTTCAAATCGAGCTTCTGAATGTCCTCAGGCGTCCGGATAGGATCCGGCAGCACTGGGCCCACTTTTGTCACCA
TCTTGACCTCCATGCCCATCGCCTGCGGAATCACTAAAATGTCCGAGAATATGATCACTGCATCCACGTGATAGCGCCGTAAAGGCTGCAAACTCACTTC
CACTGCAAGCGGCGGCACTTGGCACATCTAAACCAGTTAACAAATTTAGCATCAAATGTTAGTGAGACAAAAAAAGGTTCCAAACAGAGCCGTGTACGCC
AAAAAAAGCTCTTTTCTGCTAAATATCGTGGAGTGTATCCATACCGTGAAAAAATCGTAACCCTTCTTGCGTAGCTCTTGGAACTCGGGCAAATGACTGG
TCAATAATCCACATACACCACACAAGTGTCAGTTCTACTAAGTACGATTGGCGTAACCCATATATTTTGTGTACCACTTGCCGTCCAGCTTGGCGCATAC
ACCACACAGGCACCCGCTCAGTAGCATCACCGCGTAATGCCCGGAGCAATAAATCGTTCTTGAGCTTGGGCAGCTGGTCCAACGGTACGCGCTCGAGCGG
CGTGCGCGCCATAGGAAATGGCAGATCATTACAGAGCTTTTCCTTGTGCTTCTGCTGCTGGCGATGGATGATGAGGGCAGCAGCGGCAGCGGCCGAGAGC
GTCACCGCCACGGTCGTTGTTACGCCTAGCTCGCCCATTGGTGTTTGTTTCTGTTAATTTTAATCTTGATATCGTAGAAAGACCGATAGGAGAGAGGGTC
AAAGAAAAATCGATGATTAGTGGAAATAGAAGCAGTCGGTTCTTGCCTAATATATGTCATTACTGACAGTACACAAAAACGCGGATGTAGAATAGAACGA
ATAGATTTAGTTGCAATAACTGGAATGCAAAACGACAAGTACAACGGTTTAGGACAGTCGAACTCAGCCGTTGGCTCGACCGTTGTCGTTATCGTAGCCG
TTGTAATTGTTCTGTCCTTAAGCCTTTTTCGTTCTCCTTTCTCTTGACTCGCTTGAGTTTCAACAACCGTCACTTTTTAATATTAAGTGTTGAATCAAAT
TTCTGACAACAGCGCGATGTTTGTGGAGCTGCAACCAGCGCACGGGTTCGTCCCACTGCTTATTGTGGGGCTATTGTTTGTAAATGTGTGGGCTGGAATC
CTAGTCGGCAAAGCTCGCAAACGTTACGGCATCGAGTACCCGCAGGTGCGACTCCACTAATGCAATGAGATACCATAGTAGTTGAGTTGAATCTTGCTTT
AAACCCTGGGTGTGCTACTATAGATGTATGCCGAAAAGAACGACAAGAATGCAAAGGCATTCAATTGTGTACAGCGTGGCCACCAGAATGTTCTGGAGAG
CATTCCGATCTTTCTCGCTCTGCTTTTCACGTCATCGTACGTTGTAGGGTCGCAGCACTATTTGCTTGATAAGAAATCTACGCAAAAATGGAGTTGACGT
GTGTACTTCGTACATGGTATGCAGAATCTACCGTCCACAGATTGCTGCCATGGCTGGACTTTTCCGCATCCTCGGCTTCATCATGTACATGCGTGGCTAC
GCATCGGGTGATCCGAAAAAGCGAATGCAAGGCGGATTCGGTACTACTTGTGGTGTTGACCTTTGGCTTGATGGACAGTATTGGCGTGACCAGTGTATTA
TTTTTGTAAATGCTGGTCAGGACATCTTGCCATGTTGGTGAATGCTGGTTTGAGTATTGAGGCAGGCTTGCACATCCTTGGACTTCTCTAATTGTGTGGA
AGTGTGACAAAGATCAATCAAGCAAGCACGACGATGGAGGTGACAAGAGCAGAACGATGTAATGGGTAGGCTATATGTATTGCGTGTTCAGAAACGATTT
GCCTCGCACCACATGGTTAGTTGGGACAATCGGTGTCCGCGGATGCGCCAGTTGGATACGATGTAGACTCGAGGCATTTGCATTCCAATTGACTATAGTA
CTACCCAACGCTCCTTTGTAACACTCTATGACTACGCCATCTTCGTGTTATGATTCACCTGACGGCATCACGCGCATTTCACAAATATGCCGACGCTCCA
GGAGGCCTCATATTTATGTGACTTACGGATACCGATAGGCCGTTACCTACGTACCAACTGGACCAATCCAGATGCGACAGTTAGGAACGAAGCTTTCGCA
CTATAAACATGACAATCTCACCAGCGGTCCTTTCCTTATTTTAAACTTATATTGCGTAAGCTTCGAAAACTCTCATCATGTGCGATAACAAATTAAAACA
GCGAGAGCAACGGCTTTTATGTTAGTACGTCGGTTCGCATAGCCATCCTCAGCTCATGTACTTGAGTACGCAAAAATGTACTGAGAAATGATGAAAGCGC
GAGAATGCGCATTATATTATAAGTTCGTGAGGGCAAAATTATACTGGAATGACTGGGGATCACACTTCTACGTACCATAAACTCGGGGAGACAATGACGA
TGTATTGATACGCGTGTGTGGCCGATCTTCGACAAACAATCCAGGACATCAACAAATGAACCGGGACGCGTCTTTACGATCCCATTTAAAACAGATGTGA
GTGGGAGCGACCTCCATTTTTATGCGAACGGTTTTCATGACCTTGGTCCAAATTGTAACGGGATTACACCAATGGTTCTGATAACCAGGTACATTGGTGT
GGTACACACAGAAAGAGATCAGTATCACCGATAAGGCATACTTTTATATCACATACGCTAAAGCGATGATACCGTACCCTATCAGTTATTGCTAGAGAAT
ATCTATCGTAATAGAGGCGACGTGGTTCTGGTGTGGTACACAAGAAGAACTACGATGAGGACTATTAAATTAGGTAACATAGTTTTAAGGCTAAAGACGT
AAGTAAGGTTTATTATCGCTATAAATCAGTAAATATATTCAGTTCCTCTTTTGATCAGTTTTAGACACGTGTCTTTCTAAGACGTCTCTGGTCGTAAGAG
TTAAGTGCCTGAGTTAAGACTAAGTACTCTTGGGCATTAGTGCCACGTGATTCCTTGGAGTCGTAGTCTCCTGAACCAGGACTAAAAGCTTAAGAGCTTG
TACATACACGAAGTGTTAAGTCTCCCTAAGTCTGTAAGACTTGAGACCCTTTAATAAATACCCATTTAGTTTAATATACTAAGAGACTCTACGAGTCTTG
AAGTCTTTCTCTGACAAAAGAGTAAGGGTACCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACATCTGATTCTGTTAAAGACTGTTTTCTATAAGG
ATGGAAACAAAGATAAACCTCTCTGAGGCCCAAGGATTAGCGCTGGAGAAACTCAGAGTGCTAGTCGGGAACGAACGAGTGGATTTAATCCTAGCACAAG
GTCCTGACGTGATTCGTGCACGTCTTGACGCTTTAATGCAGTTTGAGTCCACTTTGAATGGACAAGTACACGACCATTTGGCATCGGTTGTGCCTACTCG
ATATGTTCCCGTACCTAATAAAGAGCCAAGGGCTCGACCCCTTGTCTTGACTGTATAGACATTTGAGGGAAAAGAAGGGAAGAATCTCCTCCTGTGGATC
AGAGAGGTGGAAATGGCTATGAACTCTGCTATGCTCCAGCTGAAGCAACAGCGAGTTGGGATGGCTATCTCAAAAATGGGTGGTCGATCCATAGAATGGG
CTCTCACGTGTAACACGTCGGTAGACGAAGCTTTTCCCACATGGGGTTTGCCAAAACAGCAAATATCCCGGGTGTTTGCTCCGCCTAATCAGGCATACCG
GGTGCGTTCTCGTTTCTTATCTACTCGTCAGGGCAAGAAAGAACTATCGAACTATGTCCAGGAACTGAGAACTCTAATCGCTTCCACGCAGCTTGATCCC
TTACCAGAAATGGCTTTGGTTACCATCTTCATGGAGGGCCTTCGCACGAGCGTGGCTCGAACGGAAGTATTCCGGGTACACCCCACCTTCTTTGAGGCGG
CTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAAGGCAGCCCGTTTTGGCGCCCATGGGTACAATCCAAACTCGGTGAACTCCTGTAGTTCATTCAA
TAGACCGTAGCCTATGGACCTCAGTCTCGCCAAGACGGACGAAGAAGCAGAGCTTCGAGCTGTAGAACAGCATCGAAACATTCGACGATATTTCACGTGC
GGAAGCACAAAGCACCTACGACCTAATTCCCCTTCACGCAGGGCACGCCAGGCTACTTCAGGCCGAACCCCCGCCGCTAACCAGAACTCTGGTACGGTGC
GGGAAAACGTAGACTCCCAGTAGGCGCGGGGCGCCCTGCTGGGGAGGAAAACAAAATAGGTTCTGTTCAGCCTCTAGAAGGTATTGTCGAGCAGAATTTA
GCACCAAGGATTCCCGTGTACTCTAACACGGGGCGTGAATACAAGACAGGCTTGTTGGTCACAAAGGCGACTGTTAAGGGCTTTGACAAACCCTGATTGA
TTTTGATCGACTCCGGATCATCCGGCATTTATGTCAGACGCTGTTCTCTTGAAGGGAATCCACGT