Description :
From Genome Similarity Track
Location :
Scaffold_580:9917- 15447
Transcript NameFunction/comments
Phymu_g10964hypothetical protein PHYSODRAFT_472012
Phymu_g10965hypothetical protein PHYSODRAFT_286623
Phymu_g10966hypothetical protein
Phymu_g10967conserved hypothetical protein
Phymu_g10968hypothetical protein PHYSODRAFT_351929

Sequence
5530 bases(100 bases per row)
AATTATCCCCCATGAAGTTCTGGACAGTGCACGGTATTGAAACCGACCGGAAGGTGGTCGTGATGTCCACTGTCGTCGCCATGTTCGCCACCATGTTGTG
GCTTGTGGTCTACATTTGCTTTCGGAAGTGTTTCCGACACGTGCAGATCAAAAGGGGGAGGCGGGCAAGTCTGTACAATGCCAATCAGAGTATTTTACTT
ACGGAGAACGAACTCACATCCTTCGAGACGGCTACAGGCTCGGCTTTGAGTAAACGGTATGGGGTGATTTCGGGTTACGACAACTATTTCATTAGCGGAG
ACAAGCACTACGCCTCCATTGACGCTGTCTATGGTAACGGGTACCTCCTTGCTAACAACAAGTTCTTAGTGGCGACGGAAGATATGCTGTCGCTCTTGGT
TATGAAAATTACGCGTATTCGGTTTACGAATATCTACGTTTACTCGATACTGGGAGACGGTGGAGTGAAACAGACTGCGGAGCTCGTGTACCCAGCGACC
ATTTCATGGGCCGACCTCGCGAATTTAGACGTCACGGAGCTTGGTTGACAGCAAAGTGAACGGAGGGTCCAATGAAAGTACGACATTTCGGCACAACTTC
GAAACGGCAAACAATGAAAATGAGTTGTCTTGATCGTATAAATGCAGCAAAAATGGCTTCCTTCTGACATTAATCATTCGCCTTGTTGCCTTTATAAAGC
GCTGGGGATTCAACTGCGTGTAATAATACATCTGCGCAGTCATTCTCACTGTACAACAGGATTCTGTGAGAAGTTTATCCCGGATTATGACTATAAGTGC
TCGTCAGATTTGAATTCTGTAGTAAAACAACAAAACAACCTTCTGCACTTGTGAGCTCGACAAAAGCCGCAGCCAACGCTCAGCCAGCCTAAAACCCGTC
TAAAGAAGCATAAGAAGGTCATTTTTATCCCTCTCTTGGTCGCTTATACCCGTCCGTGAAGCCAAGTATCTCGTGTTCGTAGCCTGTGATGGCCCAGGTG
GCAAGGTTCGTTTCCGGTGATGACCCGGGCAATAAGTCGCTGTACTCACGATTACGGCTTTGGGGATTGCGTAAATCTGCGTGTGTTGATTAGTAAAGCG
ACTTACGAGTCTCCGCGTTTCTCGACTGTTTTGTCATTCTCCAACTTCCTCTCAAGTGCAGCAGTTAACCCCCAAGCTCTCCCTATGGTTcgcatcgtca
tcgtcggaGGAGGTCCTGCAGGTATTGCTGCGGCCCAAGCTCTAGCCAAAGACCTCACCCCCAACGACGGCACAGAGGTCATCGTTTTCGAAAAGAGCAA
GTACTATTACCACGCCGTCGGAACGCCGCGAGCGGTTGTCGACGCCGAAtacaccaagaagctcttcgtgccGTACGACAACGCCGTCCCTGCTGAAGCT
CGGTCCTTCGTCAAGATCCAACGCGCCATTGTCACCCGTATTGCGCCCGGTAACGAGGTGGAGTACACTCCTAttggcgacgacgacgagatgctggccG
GTCCAGTCCAGCGCCTGTCGTACGACTACTTGGTGATGGCCACGGGCAGCACGTACACGGTCCCTCTGAAGCAGCCAAAGAACAGCTTTAAGCGCTCAAC
GACGGAGCTAAGGATGGCGGAGCTGCGCCAACAGATTGAAAATGCCGACAGTATCCTCATCGTCGGCGGTGGAGCCACCGGTGCCGGAGTGGCTGGCGAg
atcaaggccaagttccccaagaagagcgtgacTATTATTGAAGGAAAGGACAAGCTCCTGGGCACGGACAATGTCCGGGAGAAGTTCCGTGtgaggctgt
tgaagttcCTCAAGCGGTTGGACGTGAACGTCGTGCTGGGCGAGCGACTGACGGAGCGACTGAgcggcaacagcttcgagcGCCGCACGTTGCGCACCGA
CAAGGGCCGAGAGCTCGTGTCGGACATCCAACTGCTGTGCGGCGGCTTCAGCCCCGCGACGGAGCTGATTAAGAGTCTGGACGCGACTCTGGTGACGCCT
CAGGGGCTGATCAAGGTCAACAGCAAACTGCAACTGGACGATTCAAGGTACGCGAACGTCTACGCGTTGGGCGATGCGAACAACAACTCGGCGCCCAAAC
ACATGCTGTTCGCCAGTCAGCAGGGCACGCACCTTGGTAgggagctggcgcttgtggCGCGCAAGACACAGGCGAACGTGAGCAAGAGCTTCCCAAAGGT
GGAGGTGGCACCGGCCATGATCCCTCTCGGCCCGAACGGAGGCGTCTCCCAGCTGCCAATCTTCGGCGGAGTCGTGTACGGCAACTTCATCACTCGGACG
TTCAAGTCGAAGGAATACTTCGCTAGCTTTGCCTGGAAGAACCTGAATGCTGAAGTGCCAAACTAAAACCGCTTCTGGGAATATTAGATTTTACAGTCGT
GTCCTTTCGGTATTAGTTTTCACAATTTTAAGATACTTCAAAGCaattacttcgaagtaaacAAGAACAATTGAGGAAAGACACGATGTGCATGGCGCTC
CGTGACGTGGTTTCCTCTCTCCTGGCAACGCACTGGTCGCCTCGGTTCGTGTCGTAGTGAGATTTACTTATTATGAAGTTCTCACCAACGTTTACCTGAT
TCCGTAGccgtgacgaagacgaaaacgaggcggaagaagctctcaCTGTCAGCTCTCAATCAACTCCTCTTGTTAGTCACACAAGCTTTGTCACTACTAT
TGGTGGCATCCAGATATCACTTGTCCTTGCAGTCATTACCCACCATGACGCATCGTCTGGACTCCTTCACCAACAAACAACCGCAGAGTGGGCGTTTTCA
AGTGCTGACGGTCATTTCGCGGTGTTTGCCCAACAGCCAACTCAAATCTTCCGCTCAGTGACGTTGTCTGTGTTTAAATCGTATGCGAGTGACCTCCTGA
AGATCATTTCCCGTCGTTCTGCTGAGTGGGCTATAGGCAGCAAGTGGATGTGGGCCACAACGACAGGAAACAAGGAGATGAGGAGGACGGCGTCCAAGGA
GTTTAGTTACCACGAAGAAAAGGACGACGAAAATGAATACGCGACAAAGgaagaaatgaagaagaaacagacGGTCAGTCCACGCTACTTGGACTACGAA
CGGACCTGGTCGTATTCTTCCAAGCGCCAGGAAAACTTGgagcgccgtcgtctccagcaacgccaacgcggGAGGCAGTAAAAGTCACGGGAAAAAACGT
CAACATTGCTTTTGGTCCCCAAGCTCTACGCGTAGAATTTAAACAGTATCGTCCATTTAGTTATTTAATTGAAGTAGTGCAAAAGGAGTGCAACAAATAG
TATTTTGAGAACCGTAAATGGCTTTTTCAGCACGGCACGAATTCACCCCCAGACAAGAAATTTTTCATACCTCGAAAAATCCCCCATGCAcgagaaaaga
aaaacaTAAAGATGAATCCGAATTCTCCATCATGCGAGAGGTCTTGGCCTTTGCCCAGCTCTCGGATGCACTGTTGGTAGTGCTCAACATTCGCCCCTCC
TGGGTGTTTGGACGGGGCGTACGAGAGTCCACCGTGAGCGAACGATGCCGCGAGTACATCAAGATTCCAGCAGCTATCGGACACGAGACGTCGACGCACG
CCGTTCCCACTCAGCACGTGCGAGAGATAGTAATCGTCACCAAGGAAGCAGTTCTTGGACAGGTTGGCTATCTCGAACGCGGACATTGTCTTTTCCTCCA
TCCCGAAGAATTTACGCTTGACAACgacgccaccagctcctcctaCAAATGAAACACTATTCacgccaagctcaaggctgcGTCCACAGTACAGTCTGTC
CTCCGCTGAGATCCAACCGCCCACCACTGCAATCGCGTCATCCGGGTACTTGTGTGTGTAGTGCAGCGCTCGTTCACACAACTGAGGAGGGTACACcctg
tcgtcgtcaccatACACGATGATGGTGTCCGGGTCCTGTTCCACTAAAAGAGTCCCCAACACTTTACTCGCCGGTCCAAAATCAGTGTCCAGCACGATGA
GTCGCAGTTTGGCATGGTACGGACTCGACCCGGTGGCGAAGGTGATGCCACGGAATTCGGTCCGGTTCAACGTCGCGTCATCCTCCAGAAGCCACGACGG
GATTTCCACCGCTTTTTCTCGGTACATCCGAGGGACGATGACATACACCgcgtcgaagccgtcgccCTCTTGATGCACCAATGCATCCACCGTAGGTTTC
ATCACGTCCATTTCTATGGGGATCGTCGTAAAACTAAAGACGATACGCGGTCGCGCCTGTGTCAATCTCGTTGCGGCGGTTGCTAGGCGTGTAGATgagt
ggaagaagaagaggaagagcacgatCCAAGCGACggaagtggccaagaagcacgcAAACCACCGCTTCCGTCTGCTAAGGTCACCTTCGGGGAGCGTGGA
AGACTCCAGGACGATTTTCTCCGGCAATAGCTTGGCCAATTGACGGGTCCgtcgccgacgccgacggtgccgaacgagaaggaaCGTGAGGGCCGACAGC
CCCGTGAGCAGTGAAAGCAGAGAAATCCGTGGGATCATGACCTTTTCCGCGTACAAATCGATGCAGGCGTCGCCAATGGTGCTGCTGACAGACGTTTGCA
GGGAGTCCCTAAGGGTCTGTGTCGGCATGGCTGCCAAAGAGGAAGTTTCTAAGTGGCTGACATCGGTGCCACGCAAAGGTTTTAAAGGTTAGGTACTGTA
GCTTTTGGCGCGTCGAGATTCATTTCACTGTCGCACACTTCGGAGGATTATGGGGGCCCTGTCAACCTACTGCCAAAGTTTATGGTAAAGAGACGAAAAT
GCCCTCCACCTATCAACGCCAGAAAGCGGAAGGTTCACTGTTTAACCTGAATTATCTTTTACTTCGAGTAAGTTACCCAACAAATTCTTTCACCAATTGC
AGATGTTTGTGGTCGGGtgctgcatcgtcgtcgacgtctccagcaccgcaaAGGACGTGGTAACGTTGTCCATCCCAAAGTTGCCGAAGTCACTGATCCC
CCCTTCGCTCGTGTCTACCATCGCCGCCTTGCCAGTGCAGTTGTTGCCAACGTAGAAGGCAAGTTTTACCTGCTGGTCAGCGATGGTTGATCCTTTAATC
GGAAGCCCTGCCCAACGAGCGGAGGAGATACTGTCACTTAAATCGGAGCATGGCATGTCGTAGCAGAGATTCCCTGCGGAAACGCCAATGATGCGACGAA
GTCTCTTGAAATCCGGTTCCTTGTAGATCCGCAACTCGCCTTGCATTGCCCTCGCTGTTTCGACACTGCAAGCGAGCGCAACAATGACAGagaacagcag
cgctggcACGAGGCGAGAAACCATCGGTCGATGTCCAGTTGCACTGTGAATTGAAGACTGAGCAGTGTTTCAGGTGAACCGCAGGGTCGAATATTTCAGC
ACAGCCTTCCACCACGAGATCAAGACCGTGTTGTCCTCGTATGACCCGAGCAGCTACGTTTCACGGTTAAAGTCCACACCAATGCGGCTTATAGTTTTAA
AATCCTGTGCTACTGCTAATTGTACATGTG