Description :
From Genome Similarity Track
Location :
Scaffold_470:9917- 11913
Transcript NameFunction/comments
Phyra_86118reverse transcriptase

Sequence
1996 bases(100 bases per row)
GGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGCGCCGGGAACGAAGTATTGCGTCACGCGA
CAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAACCGACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCG
CGCCTACGTTCTGTGTAAAGAAACCACAGGGCGGGTGGCACATCGTTCATGCGTACAACAAGCTGAATGATGCGACGGTACCGTCGCAGACGCCGACACC
TCGAAAAGATGTGATCATCGATTCGATGACATCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGAT
ATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCG
TCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGATGTGGAGAT
GCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTA
CCTGGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATAGCCTACACCTTCAAACGTAAAGGAACTGCGGC
AGTTCCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAACAACTACGCGGGCAAGATTCGCCCGCTGTCGCTGCTCTTAAAGAAAGAGGCTGCATGGGA
ATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTT
GTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGC
CAGCTGAGCGCAATTACCCGGTGTATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAATTTCGAGTGTATCTACTTGGGAGTAGACCATTCGT
GGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGAAGGGCACGGTGGCTGTCATTCTTGGCGGAATACAACTTC
CAGGTTGAGTACAAACTTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGCGCAAGAGGCCGACGCCAACGCAGTTGGCG
TCGTCAGGACGACTACACCCTCGTCGTTCTTGTTGGATGACGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGTTGGAGTACTTTTCCAC
ACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCCGTCGAC
GACAACGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTG
AGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGTGAAGTATGCCAGTGCGTGAA
GCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGAC
AACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACG