Description :
From Genome Similarity Track
Location :
contig_73:99118- 100752
Sequence
1634 bases(100 bases per row)
CTTGGAGTCGATGCCCACGTTGGCAGTGAGGGAAGTGACGGATTCCGCGCAGAGATTGGTGTAGGTCTTGAGAGTGTTCGAAACCCACCGGCCGTGAAAT
TGAGTCGTCATGGCATCCATGCCTGTCCGATACATGTGTGTTGGACCTCAGGCACGGGAGGAGTACGGGCTGACGTTCTTTGGATCATCACCATTCTGTA
CAGCGGCCTCCTTGATCCCACTCGACAGGTGTGCCGTTGAAATACACGCCGACCGGCCGGCGCGCCCCAGATATACTGCCGCTGGTATTCCGGGAGGAAG
GTCTTGCTTCGACCGTAGAAGAAGAAGAGCACCGAAGACAGGGAAGCCCTCATCGATACAACATTCGAGCTGTTGCATGCCCGCACTGATTGGTTTGGAA
CCGCAAAGCCTCATGTATACAGATCGTGCATCATACGCCAGTAGGGTTGGTTCCCCCGTTGCATCACGGGCATCCAGGCCCTCAGTTCTAAGCGCAAACC
ACTGGAACGAGTTTCTGCTGATGGAGACAATTTCTGAGCGCATCAAGAGGAAAAAGACCGCCACACACACGACTCCCAAGAGAGCTTGGGCGAAGGGATC
ATCGGACTAGAGAGAATGGAAGCAGGTTTCGAGGAGCCGAATGGACACTGGAGCCTTGTGACGCGAAGATGAGTCAAATCGGCATATCCCTTTCAGACGC
ATGCGAATGTGTGGGTGTGCAACCGGACGGATCCTTCTGGTCGCTGCAAAAACGTGACGAACGTGTTGAAGATTGATGATCCGTGTAGCTGGCCGCCAGT
GCCAAATCCGTATTGAAACCCGTGCCGATAAATTTAGAGTGTGTTTCAATGTGGTCCTCGTCGGTGACGCCCGACAGCCATAGCTGAATCCCTCGACGTG
ATGTCTATACCATCCACTTTTTCATCTCTGTAGAATACTTGGTGAAAGTGGAGTCGGCAACAGAATGCTCGCGGAGATATTGCACCAGAGCACTGACAGT
CCGTGGATGTCTATCGTCGGTGATGCCTGCGTCCAACCACGAGTTAGTTATTCGAACAGGGTAGCGTAAGCCGGGTGAGCAGCAATGCGTGAACAAGCGT
CTACGCGGGTGTAGTCGACCCCGGCAATATGGGAAGCCGAGAAACGGAGATTGAGATAGCTCTCCCAGTATCCCAGGAGCCTGATAATGGCTTGGGCACG
AGTGTTACGTGACGCGAGGCGATTTTGCCAGGCCACCGCCGATGTATTACGATACGGAATTGTATGTCGAGGGGCGACGTTCATCAGCAGCACACTCGAA
CCACCGCCGACCCCATTCGTGGGTAACGATTGCGCAAGAGAGCAATTCCCGGAAATCAATGTTGAAATCGTTGGCTTCCCCGGTCTTGAAGCGAGCGATT
AACTGAAGCTCATAGGCGAAAATCGGTAAGGCAGCGCAATATTGGTCTTCGAATCGAGAGCGCACAGTCCGTGGTCGCATGCGTCCATCTCAACGACGAC
ATCGGACCCCGGGAGACTGTTAAATTACTCGAGGGTGACGCCATTCAGGAGCGCGGGGTGAGGAATCTGCCACCATCAGAGAAGTTCTTGTTTCGTGGCG
TCGCATACCGTGACATGTCAAAACCGGTGAAGGT