Description :
From Genome Similarity Track
Location :
Scaffold_32:9911- 11108
Transcript NameFunction/comments
Hyaar_Emoy2804804hypothetical protein
Hyaar_Emoy2804805CRE-LST-2 protein

Sequence
1197 bases(100 bases per row)
ATTTCCCGTCACATACACAAGTCGGAGGAGCTCCACCCACAGACGCATCCACCCACTCATATGCCGGTACTTCCCGATACAACGCCGTCTCCCGGCTCGA
AACCGTCTTCCCCCACGCGCAATGAGACGCCGTTCCAGCTCGAGCGCCAGCAACTGGCCGAGCAGACGCGCGCGAACATTGAAAAGTTCGTCGACGGCCT
CATGAGCGACGAGTTTTCGCTCGCGCAGCTCCTGAACGAGAGCTTTTCGCCCGAGATGCTCGAGCTGCTGTTCAAGCGCATGACGAATCGGTTACGTGGT
ATTTTATTCTCCCAGGACAAGACGCGGGAGCTTATTCGCTTGGCACTGGACGTGACGTACCCATCGCACACACGGGCAATGGCTACACAATTCATTGTCG
TGGGCGGGGCCGTGAATGCCATTGCAGCGTGTGAGCCAATGAGCGCCAAGCACGAGTGTGACGAGTTCTGGGACCTCCTGTTTTGTACGTTACATCGAGA
AGCCGATGGCGTGTTGTCGAAATGCGACACACCGTCCCGACGCCAAGAGCGACAGGAGTCGGTGGCTGAGATGGAGGAGCTCATTCAAGTGGCGGTGCAA
GTGTTTGAGAAGGACGGGGCCCAGACATTGCAGCAGAGTTTTGCAGACCACGAGGAGGAGATTGAGAAGAAGAAGGAGGAGAAGATATTGGATGAGCGGG
TGCCTCAGCAAAAGCAGCAGCAGAAGCAGCTGGCTGACCGACGGAGATCGTCGGCGGGCTCCCCGACGGCATCGGAGAATGATGGTACCAAGGGCTTTTT
TCGAGCTGTTCAGTCTCCTTTGCAGTCGCCTGTCAACGGCGAGCTACTGCTGCTTGGTGCACGAGAGAGGAGAGACGACAATGTGCTACGGGATAGCACG
GAGATCAAGAGGAGGGTCATACTGGACAATGGAGAGGGGTTGGAGGTGGAAGAACCAGATGATACGGGCATTCCAGCCCCGTTGACGACTGAAGTGAATG
CAACTGCCATGTACGGCATCTTTGGCCACGACTCGGCCAACTTTGCGTCGCAGATCTTGCGCTATTTTGCTATTAGAGGACAGAAAGGAGCCTGTATCTT
GCACTATTTGGCCGACCATCCTGCGACGGTGGACATGCTGCTGGCCAATGTCGGCCATGATGATATCCGCACGCTGCTCCTGCACCTCATTTACGCA