Description :
From Genome Similarity Track
Location :
Scaffold_1986:991- 3401
Sequence
2410 bases(100 bases per row)
ACAGGAACGAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATA
TGCCCTTGTGAAGCTCCGTGTTCACCTTCTGGGCTCTAGGCGCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTC
TCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCACTCTCTC
GGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGCGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTAT
CGTCAAGTTCCGTAAGGCCGGAACGAGCGCGAAGCCCGACTGGCTCTCGTCGCGACAGCTCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTC
TATTATCGGGTGGAGTCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCATCGCGGAGGCGCATGACGCGCCCTCCA
GCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGTGA
AACATGTCAGCGGGTCAACCCGCAGGGCACTCTTCGGCTCCACGACAGAGCCTGCCCGTACCGGCTGATTGTTTGAAGTCGATGAGACTTGACTTCATCT
TTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGCTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAAC
GGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGACCGAGACCCACGGTTCACTGCTGCG
TTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGC
TCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAACTTCCAGTTGTTGAGTTTGCGCTCAACAACACGGTGCACGCGTC
CACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCATCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGTG
GCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCA
GGGTCCGCGATACCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGAAAACTTAAGTATATTTGAGGTTGGGGACTTAGT
GTTGCTAGACACGAGGAACCTACCTCTTGACACTGTCAGCCCTGTCGGCAGCAACAAACTGAAGCATCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGA
CATGGTGCGTCGTACACCATCGACTTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTG
CTGACTCGCAGTCCCCCCTTGACCCAGCTCCTCGAAGCGAGAGCCGGTCACGGTCGTCGACGAGGGCGTCGGAGCAGGCACCAAAGCCTCGGTCGGAACG
GCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAGCGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACG
CGAACGTCTGGGAGTGTGGCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGGTCATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGC
CCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCTAACAGGTCCAGGCGGCCCGCAAGACCAGCGAGCTCGCCCTGATTCCCGGTCTGGACG
GCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCCACCTCAGGGTCCTGTGTCGGACCCGCAGTCG
GAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTCGATCGGAATGGAGAAGTTCACTTCC
ACGTGGAGCGGATCCTCCAGGAGCGACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTAATGCCCACACTGAGAACTCGTGGGAGCAAAT
AAACGGCTCC