Description :
From Genome Similarity Track
Location :
Scaffold_21:99086- 101078
Transcript NameFunction/comments
Physo_254237formamidopyrimidine-DNA glycosylase

Sequence
1992 bases(100 bases per row)
TCCGCTTCGTTTGCATCTCCAGTGTCCACAGCTGCTTCGAACGCAAGTGTTTGCCACTCCCGATAGCGGTTTGAATCCTTCCTAGCGAATCCAGGTCGAC
GCGGGATCTGCCCAACGGGTAACCAGATTGCCAAACACACCAAACGATCCAGTACCAGGCGGCTCGTGCTGATGTTGGTGATCCGGAGGTATGACTTGTT
ACTGAATCTACCATTCACCACCGTGATCACCCATTTTCCCCCTCTCGTTACCCACAGTTCAAACCGCCTGTTGTGGGACTTGAGTGAGATCTCTGTCCAT
TGGCCAGGACCGACTTCATGGAATCCCGTTGCGTAGACTGCGTCAGCCTTGCTGCTATACAGTGGCTTACGGTCAGTCATCTGGATGCGAACTTCGTCCG
GCAGACAGAGCGTTCCGTCAGCCAGGTCCAACTTCACCCCCGCAGGAACCATAAAATCCATGCCGAGAATGACGTCTTGTCCTGAGAGATCTCCAACCCA
CACACGAAACTTGTACACCAACTCTCCAGCCAGAGTGAGCTTGACTTCTGCTCGGCCTTCTGTGCGGTACACAGCATCCCCCACACCAACACAATCCATT
GTCTGTGTTGTATCAATTTCACAACCCACCTTACGTGCAAAGGTAGAGTCGATTATCGACACTTCGGCTCCAGTATCAAAGAGTAGGACGGCACGGACAT
TGTTGACCGCACCGGTCGCCTTCGACTGCTTGAACCACTTGGAGGGAGTGTAATACTTCCAGTAACCTCGGCGTTCACCCGGCGACAGTCGAAGGACCAT
CACACAAGGGCGACGCGAGTAGTCATCTTCATCCGAGGTAAGAGATCTGACTGTATTCACCGCATTACAGGAAGTTGGGTCTTCTAACGCTCGCGCCTTC
CTCTGAACATATGCATAAATGCAGAACTTCGATCGCTCGTCACGTAACAGGCTGTTCAGGCCTGGCGAGCGGTCTAGTTTAACGCCTTCTCGACGCTCTC
GGGCAGCAGTCCGGCATGGCGAGTCGGGTTGTACCATTGGCGAACAGCATCGAAGAAGTCGCCGATTTTACACTGACCTGCTTCGTGAACGTCTCCACAG
CACTTGCAGACGTAGAAGCACTTGTCGGTAGGATGGCCCATGCGTCCACACTTCTGGCACGTGAGCCTCTTCCAGCACCCGAGATCCGTATGCTTGCGAG
ATCCGCAGTGTGAGCATCGAGTGCCGTACTTCGGACGCCCCAGTTGGTCTTCGCGGTCCTGGCGCGCTCACCATCTCCTGGTGTAGGCGTCCTAGCTGCC
GAAAACACGTGTGCTCTTTCGTCTGCAGATTCGCTATCGGAACTGCTTAATTCGCCCTCGAACTCGTTGAGATCTCCGTGATCTCCGCGGCGTCCGCGAC
CGGTAGTCACAACCCGCGCCGCCCTCGAGGAGGCTACAGGGGCGGGAGCCTTTTGGCGGTATTTCGAACCTTGCGTCTCAATCTTGCGACGTTGGTGGCG
GCGTCGCATGGCCAACAGGACGCCTTCGAGAGCTTCTGAGTCAGGCAGCCTCAACACTACCAGAGATCCGGCGAGATCGTGTATCGATGTAGTGGTCGAC
GTGTTCACGTCGTTGTTCCTTGGTGCCATCATGGATCTTCAAGTTTGCACGTATCCCGGCCAGATTCAGCCGGTATAAGCAATCCAGTGGGTCTTCCTGA
CTCCCGCGCCGCATGTGGTAGTACTTGCGCGCGAGGGAGATCCCTTTACCGCAAAAGTGGATCTGGAACTGTTCACCCAGGTCAGTCCACGACGCGCGAG
CGGTGCGGCTCAGCTGGTAATACCAATTGCGTGCAGGGCCTATCATCAAATCGGCAAATGTCAAGCACATCTCGTCTGGCTGCATCTGATCCCGTCGGAA
GGCCGTTCTAACCTTGTTGAACCAGGCTCGGGCGGCTTCTTCGTCATGTTCCTTGCCGCTGAAGTCCTTTAGTTTGGACACAGCCGATGCTC