Description :
From Genome Similarity Track
Location :
Scaffold_88:99084- 100959
Sequence
1875 bases(100 bases per row)
CAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTTAACTACTTATA
TAGGCCAACCAGTAAAATAAGAGCACGCTACTAGCACGAGCAAAGCTAGCAGGTGTTTTGAATCCTCGTGGTCCCAACAGCGGAAGGGTACCAGGCACGG
GTAAGCCTTTTACGAGATCACCGAGTGTTCAACACTCGGCTGGAAGAAATAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACAATAA
GCCGTCACGTAAAACCTCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGCTCACCGACAGG
CATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTACCCT
TTCGGGTCTATTCCTAATAAGAAGTCCTAATCAAGTATACAAATATCAAGTGAACAATGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGAC
CATGTTGGTGTTTCTCTCAATAACCACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAATTCATCCACTTGGCGCAAACC
AGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGGCTTGTTCACAAATGCA
TAAATGCAATACCTAGAACGCTCGTCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTTACATCTTCTCGGCCACTTCTGGCAACATCCCTCTGTG
CTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAG
CAATGATCTTCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTTCGGGATCTGCACTGCGAACACC
TGACTTGTGCTGCCTCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCTCCGGGTACGGTATCCCCCGGTCGAGAGTTGTATCCGACCTTCGCCGT
TCGATCGTTGGACGCAGTGAGGCAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACT
TGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAACCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCA
CAGCCCGCAGCACTTCCTCAAGTTCGTCTGCGTCGGGAAGTCGTAGCAGGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAAACGTTTCGATGAAATGA
TCCACGTGTTCCCGCAGGTACCTTGGGATCCCCCATCCCTTGATCTTAAACTGTGGCCCGTAGATCGGGCCACATTTAGTCGATGTAGGTATTTCCAGCG
GGGAATTCATCCCGATCTGCGGCGGAGCATGGGTAGTATTGTCGGTGGCACCGAATACTCCCGATCCAAACGTACTGGGGTCCTGGTAACTTGCGCAGCA
AAATCTGGCCACTTGTTCCTGGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN