Description :
From Genome Similarity Track
Location :
Scaffold_160:9907- 11034
Transcript NameFunction/comments
Phyci_97294Hypothetical protein

Sequence
1127 bases(100 bases per row)
CGAGTACGCTGGAAGCTTCAGCAAGTTCATGCACGTGGCACTGGATGGTAGTCGCTCGTCGTCCTCCACGCGCACCTGGTGAATGCAGATTTGCGGATAC
AACTGCGAGAACCCCAACAGTGGTTGACGAGAGCAGCTCGTGATGAACTTGAGTAGAGCTGCGCGGTCTTCGGGCTTGAAGTCCTCCCGAACGATCTCCC
AGAACCACTGGATGATCCGCTGTGACGGGTGGTAGCCGCCTCCGTACTGCGTGTTGCGCTCCCAGTCGTCGATGTCGATGTTCGTAGCTGAACCACCGAT
GAGCATCTGCAGCTCGGCCGGTGCGAACATCTGAATCCAAGTGCCCGGGATCAAGTCACGGAAGCCCTTAAGGAACGCGGTGCTCTCCATAGATGAAAGC
ACATTCAGCTTGTAGTTGGCCATCAGATGAATGTACCGAATTCGGTTTTCGTTCGTGACGGGGATGTTGGCTCCGTCAGGCACGAGGTTTCGTGTCACAA
CTTCACCGAACTCCATCTCACTTACGCTGAACGTCAACGCCAGGTCTTCCACGTTACCGTCGTAGTGCTTGAGGCGCATGAGGGACTTGTATAGCTCCGG
GTCGAGCGAGTGCAAGTCGTCGATGTAGTTGAACTTGCCCAGCAATTTGTTCAGGAAAAACGCAGCAAACTGCGGCTCCACCAAGATGTTTTCGTACACA
GCCTTCGCTAGAACGCGCCCCAAGAACCTGTAACGATCCAGCGCCTCCTTTCGTGTGTCTACGATATATCTCGCGCCTGGGTTCGGATAAAGAAGTTGGT
CGTCCGTTGCCAGGAAGAAGCCGTACTCTGGAGAGAAAGCATTCTTTGTCAGGTTGTCCATATACTCCTTGAACACGCCTCCACCGTCGATGCCGGCCTC
CTCCAGGCCTTGCTCGTTGACAAACGTAACCTTGACGCGGGACTTGAGGGCCGCAGGAGACATTGTGTCGCAGACTTTCTGGAAGAAATCAAAGCTGTCG
TCTACAATCTCATCGCGCTTCACACGCACTTGCAGAGCTCGCGAAAACTCGTCACGGATGTTGCCCAGTTGGGCCTTCCCGTCTTCTAGCAGCTTTTGGA
AGAGCTGTACGCGATCGTTGAATGACA