Description :
From Genome Similarity Track
Location :
Scaffold_440:9906- 27202
Transcript NameFunction/comments
g15158.t1hypothetical protein
g15159.t1hypothetical protein
g15160.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g15161.t1hypothetical protein
g15162.t1hypothetical protein

Sequence
17296 bases(100 bases per row)
CACGCGCAATTTCGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACTCTCGGTAGCTTTCCAGATTAGTTCTC
GTCAGCAACTTGAACCATCTGCAATCGTCGTTCGCTGCGCCGAGTCCGCAGATAATCGTAAAGTAGCCCGCCACATGATAAATTTGAGGCAGGTTCCCAC
GTGGGCTCGTCATACCCAATCCACTTCACTTTGAACTCTCGGACAGCACGGCTAGTGCTCGTCGACAACGGGGATCGGTCATCGAGGATGGCTTCTACCT
CATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTATCCTCGGTCACTTCAGGTGCTAACCG
ACTCTTCGGTCGGTCTCCGAATTCGTTGACGGCCTTGAGTCGGGACACGTGTACCACCGGGTAGAATCTATACCCGCTCCGGTCTGGCAATTCCAACTCG
TACGCAAACTCTTCGATCTTCTTCTTGATCCTGAATGGCCCATGCCATCGGTGGGCGAGTTTCTTGGTCAACCCTGGCTTGACTCGTTCCATATACAACC
AAACTCTGCTTCCGGGTTGAAACAGAGACCTCGGTCCTTCGACAGTGGAGTCAGATGTTGCCCCCGTCTCCACCTGTGACTCGTCAGGAGTCTTGTCTTC
ATCGATATTCGGTACTGCAGCTCTCTCGCGCCGTTCCAGCGACTCATTGTGTTCTCTCGCCCTCCGAGCTTTCTCGACGCTTTGGTACTCCATTGCCATT
CTCCACGAGATTTCCTGTTGTCGGTTCACTTCTCGGCGCCATGCCAATGCGTCAGTCTGGCCTCCGAATCCTCGTTTGAGTGACGACGACATCGATCGCA
GCGTGGACTGCGCGTCCCACCCATGAACTAGGTAGAACGGAGTGTCCTTTCGGGTGCCATCTTGAGAGTTGTTGATAGCGAAAATCAATCGCTGCGCAAT
CTCGTCCCAGTCTTGCTGTAGCGGGTCTTCCGCGTACACCCGCACCGACTGCATGACCGTCTTCACCGACCTCTCTTGCTGTCCGTTCGCCTGCGGCCGA
TAACTCAGGGTCGCTCTTGACCGAGACTGCATCATCTCTGCAAAGGCCTGGAACACCTCGCTCATGAAGCGAAGGTCTCGGTCATGTCGGGTTAGAGTTG
GTGCTCCGAATCTTCGGTACACGCATTCCTCGAAAGCCTGTGCGACCTTCAGAGCGGTAGTGTCCGACATAGCTTTACCCATGACGAATCCTGTAAACGC
GCACTGGAACAGTAATAAAGCTGAGTTGCCTCGACGAGACTTCGGTAATGGTATGACAAAATCCATCGACACCATCTGGAACGGTCGCTCTGCCAAGACG
TTTGCTGGCGAATAGCCTCGGAACTGTGGTCGACTTTTGCTCGAACTACAGTCGGGGCAGGACTTGACGTGCCGTTCGGCGTCTGCGTATAGTCTGATCC
AAAAATAGTCTGATTTGACTCGGTGGTACGTTCGACCGATACCTTGGTGGCCACCTTCCAACGAGTCGTGGCAACTCCGTAGTACTTCCTGAATCATCGT
TGTGGGCACAACTAGACGCATCGTTGTCTCCTCTCGGCGTTCGTTGCCCCACCGACGGTTCGCTCCAAGAAAATACAGTACACCATCCTCGCTAAGCACG
AACTTGTCGGCCATCTTCCAAGCGTCTCTGGCTGCTCTGTAGCTGAGGTCTGTTTCCTTGCCTCGGAGGACCGCTTTTAGGTTCGACCATCTCAGCTCTT
CATCCTGGGCGGCGGAGATTCGTCTCCGGCGCTCTTCCTGTATAACCACAGGGTCAACGTCTTCTGCGTTCGGAACGCTAGAGTCCGCCTCGTTGTTCGA
CTGTTCAGCTCTCAGCTCGTTCTGAGCTTCGGTGGTCACACCATTCGCTTCATCTCGTTCAGCCGCATCGTTCGGACCTATCACTGAAATTTCATCTGCA
AACTGGACTCGTTTCTTCCTCGCTTTTGCTTGGTGTCTGGTCGTTGCAGTTAGGTAGTCTGGTCCGTCCCGCACAAAGTCGAAAAAAGATTTGTCGTGAG
AGATTCCATGGGCTACCTGGACTCGGGCGAAGGTCACCGCCGGTTTTTCTTCGGCCGTGGTCTGTACTGAGGGTTCATAGATGACCTCTCCAATCCGGTT
CAGCTCGACCAATTCTGATTTCCTAGTCTCGGTCGAAGCTACGCTGGATTCTTTGCTGCTGAGAGCCTCGCCTGCCGAATCTGCCGCAGCGTTAAACTCT
CGGACTACGTGCAAATACTTCACTGACCGCAGCTTGGTCGTGAGTTCTCGGTGACGATTCTGTTGTACCATCAGAGACTCCTTTCGACATGCCATCACCC
CTAGGGACTGCTGGATTGCGAGTCTCGAGTCTCCAACGATGACCAAATCCTCGGCTTCATGTTCGAGCGCAGCCGAGATACCGTTATTCATTCCGGCATA
CTCAGCGAGGTTTACCGTGGTGGTCTCGAGATAAGCACTCGCAGCCGTCACTACAGTCCATTCTGGTAATTTCCACAAAATCCACGAGCAACTGCCGTAT
CCACCGTTCTTTTCGGTCTTGGCCGAACCATCGAACGACATCACAAATCCGGTATAGGACCTCGGTAGGCAGGCATAAAGCAAGTGGGGGTCCATACGAG
CAGTAGGTGACCCTTTCGTCGGCGGTGTAACCGGGGCCAACGAGTCTTCCAATTCCACGAAGCTTGTGAGGCCAGCTTGGAGGAGCTGAGCAAACGTGCA
ATCGCGTTCCTTGACTCGGTTGACCACCAGGTGCCACGGGGACAACATAACCGCAAAGTGGGTCGCTCGACCGAACAGTGTCTTAAATTTGTGCACCCAT
TCGAGCGTCGAAAAACGCGTATAGACGTGGATGGTCCGACCCACCAACTGGGAGTAGCACACTTTCAACACCAGCAGTAGCGCTAAGACCTCCTTCTCGG
CCATGTGGTAGTTCATCTCGGCGTCCTTGAGAACTCGGCCACAAAATCGAACCGGGTGCAACGTGTCATCGTGGTATTGCACCAAAGTGGAGCTCAATGC
CCACTCATTCGCGAATAACGTGACATGCACCTCCTTATCTCGGTCAAAGTGCCGGAGGATCGGTGCCTCTGCAACCTTCTGTTGGAGCGCCGCGAAGCTT
CGCTTGGCCGCCGAGAGGCTGTCACTAGGTGTGAAGTCTTCGTCCTTCAACTGGTACAAGGCTGCTCCATACACTGCGAAGTCCTGGATGAATCGACTGT
AATAATTCAGCGCACCGAGGAAAGACTGCATCCCTTTTTTCGAAGCGGGGAACGGCAGCTCGGTCACTACTTTCATCTTCTTGGTGTCGGCTCGAATACC
TTCAGCAGAGACTTCGTGTGACAGGAAATCCACCTTTGGCTGGACGAAGATACTCTTCGTAAAGCTCACACTAATGCGGCATTCGGTGAACCGTTGGAGC
AGTCGGTCTAGCGTCTCCAGGCACGCGTCGAAAGTCTCGGACCCAAAACAGATGTCATCGACAAACGACCGTCGGTCGAACACTGGCACCAACGAGGATT
CATCCGGTTCTCCGGTGGAGAACATGTCGGCGACAGGGCTGTTCACTAACTGGGTCACCGCATCAAGCGTGAGCGAGGATTCGCGGTCGGCCTCGAATTT
GGTCGGCCGAGTTGTTGACTCCTCGGGTGGCCGCAATGAAGGGTCGGTCACCCCTGTCCGTGCAACCTCGGCGTGGGCTTCGGTCGTTCGCATAAGCTCC
GAGAAGGGAAGCCAGCCGCCTTTCGGTTGGACGAAACCCCACAGAGCATTGTCGATCATTCGTTGGTAAATCATCGGTGCGTTCTTCAATCCAAACGGCA
TACGAAGCCATTCGAAGTGTCCGAGCGCACAGACGAATGCAGAGACCTTGCGGGCCCGCATCGTCATCATAATGGCCCAGAATCCACTGGCCGCATCAAG
CGAGCAGAACCATAAGTAGGCTTCCAGGTCGGTCAACAAGTCGTCGACCAACGGCATGACGTACTCCATAATCGCCGTAACTGCATTTACCAGCTTGTAG
TCGATGCACAACCGAATATCAACTCCATTCTTCTTGAGCACGATCACGATGGGCGACGCCCATGGGCTGTCCGAAAACGCCACTAGACGAGCTTTCAGCA
AGCCTTTCAGAAGCTCGTACAGCTTCCGAAGGTGTCGGAGCGGTGTTCTCCGAGCTCTCTGTTTGATGGGTGGATGCCCCTGTACGTCAATATCGCACAC
CACACCGTAGGCTGGTGGTGGCAGAGCATTCCCGCTCGCAATCATGATCTTCTCGTGTCGTTTCAGTACCGCAACGACACCCTCTTGTTGACGGGCGGTC
GCACTCGGGTTCAGAACATTCGGCCCTGAATAATCCAGGACCGTTTCCGAGGCTTCGGTCAGGTCCGGTAAGAACGCCAACTCGTGTGCATAGTCCGTCA
ACTCAATCTCATTCGCCAAATGTTCGGACGTATCGTTATCGGTGTTTTCACCACCTGAACCGCTTCCCGTGGTAATCTCATGCATCATTGCTACGAAGGC
AGAGTCCAATCGGGTCTCCGCGTCATCACCGAGGACTGGTGTGGATTCCTCTTCACTTGTATACGTGGTATCCGCATGTCGGTCGCCACTGAATCGGCAT
CCTCGCTGACCCAACGACCTCCAGCGGGTTCGTCAGAGGATCGCATCGTAGTCGGCGGTGGCGTTCGGTCTCGTTCTGTCGGTTCCTCGGTACTCCTATC
CGCGAGCGTTATCTGGTCCTCGTTTCGGCCTCCCAGGTCGTCGGATGGTCGAGGTAGGATGCCGCGAGGTGTCGGATAGTCTCGTCGTTCTACCGCAGGT
GGCTGGTCTGTCAACCATCGTTCGTAGAGTTTGCGTTCCCGCGCGAACAAAGTCTCGTCTCGGCACTCCGCGTACGCCAGGACTTGCCACTCATCATACT
TGGCGGAGTTCAAACGAGTGTATCCATCCCCTTGCGGCAGGTCACCCTTTTTCACCCACAGCAGCACCGATTCGTGTCTCGCGCAGTGAGCAATCTTCGG
TGACACGTTCGTTAGTCGCACCATCGTCGGCTGCCCTCGTCGAGACCTCGTTACAGTGGGCACCAGGTTTCCAATCCGGCGTGCCCACACGTCGTGAGTA
GTCAGAGGCGGCCGTCGTCGTGGTAACCTAAATTCTCGCCACTCACGCCCTGGGACCGACAAATCTTCGGTCGGGCGTCCAGTCACTTGCATGCTGTACG
GCTCGGCCTCTGCTGGGTTCTGCGACTTCACCAGGGGCACCATTACCTCGTCCGGTAGTCTCGCAGTACCGTGGAACAGATCCAACCGGACTCCGGCTGG
AATCATGAAATCCGTTCCCAAGACCATATCTACTCCTGCGCTGTGATCCATAACCCATACTTCAAATTCGTACACGCGTTCCCAGCCCAGGGTGACCTTG
ACGAGTGCTCGTCTGCTGGTCTCCATCACCCCTGGGTTAATTCCTTGCACTTCCAGACTCCTACCGTGGTCTGGGATTTCGTGCAAGCACAACCGTTTCG
CATATGACGCGGAAATCACACTGACATTCGCTCCAGTGTCCAGTAGAATCCTGGTTCGCGAGTCGTTTACAGCCCCATTGACGAGGGCTCGCAATCGCTT
CCTCTTGTCATAGCGCTGGGATGACCACCACCCCATTCTCTCGCCAGGTAACAGTTTAATCGTCTGGCCGAGGTCTCGGGATGGATGGTCGATTTTGGTC
ATGCTGAGGATCGAAGCATCGGTTAGCTCCACTCCGTCTCCGTCCGCACGTCGCCCATTCACTTCACTCTCACCGAGGCTTACGCCTCTCTCCTTTACAT
TTTCCGTCGTTTTCACATATTCCATATTCAAGTCATCAGGCCGTTTGCTCACACCTGCGAATGCGAACATATAGTCCGCATCCAGCGCAGGTTTGGCTAA
CTGTGGCAGCCCGATTGGGACCAACCCAGTTTCAGTTGGCGGGCTGCCTAGTTTAAATGACTCCCATAGACGAGTTCCTGCAATTCCGGCGAGAGGTCCT
TCTTCTCGACCTTAGCTCGGAGGAGATTTGTGAGTTCTTGGAAGGCTTCACACTTCCCGGTATCATGAACTTGCTTGCACATCTTGCATCGCTTAAAGCA
GTAGTGAGCCGAGTGGGTAAGTCCTCCGCAGGCGGCGCATGGACCATATTGGCGTCGACCATCGCGTCCGGTTGAGTTTCGGCGCTGGTCGTCTCGGTCA
TACTGACGTTGGCCGTTACTTGCCCTCGGCCGACGGTTGTCGGCGCGAACGAACGTTCCCTCAGCTGCATTGCGACGCTCAGTGTCATTTGCCGCGGCCA
CGTGGCCTCTGTCCTCGGTTGACGCATATCCGTCGTTTGAGTACCCTTCGGAATATCGGTCATCATCTCCAGAGTGAGACTCCGATCCGTACTCCTCGGC
GTCATCATATCCGCCGTTGTGTGTTTCTGGGTATCCTCCACGCGTGTCTGCCGAGCGTCCCACATTCAACGCCGTCACTATGTCAGTCAGTACGTCAGTG
AGAGTGACCCTCGATCGATACTGTTGGTCATCCCGGCGACGGTTTTCGTCTCGGTAACGGTCTTCCCGACGACGGTCGTCCTCTCGGTGACGTCGGTCGC
GGCGATAGCCGTCCCGCGGATCCTCGGAGCGTCCACCGTCGCGTCGGCGTACTACTTCTTGTCCTCGAGGGCGGCGGACCGAGGACTCGCGTCCCGATTT
TCGCTCCCGGCGACGGAGGGTATCGTTGATCATATCCTCGAGGTCGTGAATGTTCTTGACTCGGACATGGCACAGACGCTCTTCTAGACCTCGGTCTTCG
CACGAATCCAAGAAGTGCTCGACGTGGTCCTTTGCATCACGACCGCCATGCTCGAACTGCACTCCGGCGTTGCGAGCATAGCCGTTGAGTCGGTTGAGGT
AGTCGCAGACGTGCTCCTTCTCCTCTCGCTTGGCCGAGTAGTACCGAGCCTTCGCAGACTGGTTGAACCGTGAACAGTAGTACTTGATGAACGCGTCGCT
CAACAATTTCCACGTGCGCCTCGTTTTGCGGGGCAGCTGTCGGTACCAATGCAGAGCACCATCTTGGAGGCTCAGTTCGAACGCCATGCACCATTCGTTG
GGCGGCGTGTGCGTCCCTTTCATCTCGTATATGAAAGCTCGGAGCCACTGCATGGACTTCTCGCTCTTATCGCGGAGTCCCAAGTACGGCTTGATGTTTC
CGAGTGGAAGGTGCGTGGCAATCTCTAACCTCGGTGTCGTATTGTCATTCTCCACCGAGCTCAACTCACGAATTTGGGCGCCCATTCTTCCGTCACGTCA
CCCCCGGCGTCTCCGATGTCGAACGAGTCTTCGTCCGATGAGTCATCGCGGAGATCGTAACGTCGGCTAGGCGTCCGACTTGCACTTCGTCCAGCGGTTG
GTGCGGTGCGGTGGCCCTCGGCTTCTCTCGCCAGTCGTTCCGTACGACTGACCGACCTAGGCGTTACCATGTGGGAGTCTTGGAAGTACATCGAGGTCGC
ACCTTTGGCCGAAAATATTTCGGCCTCGGTCGACTCTCTGGGGCGTCTCCCGGGGGTTAATGACAACGGAATCATGGACGGGTCGACTGGATCCGATGAG
TGGCGGACGTTCGGTGGACGGCTGACTCCCGCCTCGGCCACCCCGAAGGCCGACCGAAGCTTCTGCTTCCACTTGCGGAGCGCCGTAGCGGCGTCCTCGG
GTGCCCATGCTCGGAGGTCTGCTTCCGTCGGGAACACTTGGGGCTCACATCCCATAGCGCCTAGGAGTTGCACCGTGTCCTCGGCCACCTGCTGAGTACT
CCACGACTCCACGGGCACAGTTAATTCGCCACCGAGCTCCATCCAGATGGCTTGGCGAACAACCTCTGGAACGAAGGATCGCATCCAATTGCTCTTCACC
TTCATGAGTTCTAGGTATCGGCCCAGAACTCGGTTGGCGGCCGGGATGTCTCCGTTAAGAGGAGGCCGGCCGCCATTCGGCCGAGAATTCGCATCCTCGG
CCATCGCCGACGATCACCGATCGTCGGACCTATCTTCGTCGTAACCGTTGGCTGGTTCGGGACCAGCTACTTCGTTCAACTCTTCAGTGAGGTTTCGCGC
AAGAGACCTCACCCCTCCGCTGCGTCCTGCAGACACTGCAGCGGCTTCCGAAAACTCGGGCATAGCTGCCTTCTCTTCCAGGTCATCTTCTTCGTCATCT
TCCTTGGCGTCAGAATAGTCCATCGGCTCATCAAAACTGTCCGAACGCTCGTTGATCGACGCCAACGTACTCGGCTTCGCGAACGACGAACCAGAACGCC
TCGAACCCTCGGTACGCGTTCCACTTGACCTCGCCGGCGTTGCTGGTACCGCTGACTTCGCTTCTTTCGCCATCTTCTTTCTTCTTCTCTTCTTTCTTCT
CTCGAATGCTCGTTAAGGTAAGAACCTATATGCAACCAAGACACACAGAAGGTCGCACCAATCCCAGGTCGCGGCACCAGTTGTCGTGTAGGAACACGCA
GAAAATCTCACTACCGAACGGTATGAGTCCCACCAACAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGGATCAACACCTGAAGACCAGGAACGA
TCCCTTACACCGGGTTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTACTAGCCACGAGCGAGGGCTAGAATGC
AATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGGAAGGGTACCGGCAGTCACGCATAATACGGGTTTGCCGAGGATAACCTCGGCGGGTAGT
GAAATACACTTGGGAACACTCGGGTCCTTCCAATATATAGGGACCGACACTCTCCGTCGCCCCTAACTCTCGGCCACTCCTATCTCTTGGACTGACCAGC
AACCGACTCTCGGTTCAATGTACCCCAAGCTCGCTGACAGGCATCCCATGTATCCAGACCCTAAGACAAGCTAGCTAGACTTACCGAAGACGGACTTGAC
CCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTCTTTACCTACAGCTCTGAGAGCCTCTGTAGATCATCATTTGGCTAGACCTATATCTCTATAC
AAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATGGCCGACTCTACACAGCCGAGGGTACGACACAGAATGGGTACAAACGAGGTTTTTAACCTC
GGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAGCGCGGGAAATGAGACCAGCCAATCAAGACACTCTGTCGC
CGTTCACTGAAAGGTGCAACGTCAGCCAAACCGTGACAGTTCGGCTCCAAAACCCAACGCCACACGTACACGGCGCAGCTGACCAAGCTTCGGAGTGACC
TCGCCGCGTCTGCCAAGGCCTCTGCGGGTGCGGTTCTGGCTCAGCTGCAGGCTCTGCAAGCAGAAAACGCAAGCCTGAATCGAGCCAACTCCGTCTTGCG
TCGTCATTCGGCCGCCCACGATCTGGACGTGGACACATTGGTCCTTGCCTCTGCTGGTAAGTCCTCGGTCTCCACTTGCTCGGTCGTCTCACATCCTCTA
ACACTTCATGCTTCCTCTGTCAGGTATCACCTCAGAGGACATCGACTGGGAGTTGCTCGGGCTATCGCCTCCGAGCATTTGCTCCAAGCGCAGTCGGAGT
TCTTCCTCCGAGAGCTCGGAGGACAGCCCTGATGCTGCCCCGGGTCCGAGTGAAGAGGCCAAGGCCCCAGCCGAGGTGTCCGCCGGCGCAGGGGACGACA
GCGATAAGTCGGACGACTTGCCGCTCATCCCGTCGATCTCCAAGCATCGGCGTGACAGACGCAAGCGTCTCCGGCAGCGTAGCTCCTCTCCGGCTCGCCA
TCGAAGTCGGCTCTCCCCGCTGGCAAGCGGTTAGGCCGACCGTCGGTCGACCTTCGAGCTCGCGCTCAAGGTGGCCCCTCGGGCGCTTCTGGGTCGACTC
CAGTGAGGTTTCCTGTGTCTGGGTCGACCCCCGCACCCTCGCCGAGCTCTCCGGCGGGGTCGTCATCTGGGTCTCCGACGCACACGCCTGCCCCGGATTC
TTCGGTGCCTCCATCTTCGGCCGAAGTCGTTGACTTGTCGGGGGAGGAGGTCGTCATCAAAGCTCCGGCGGCTGCGGTTCCTGCGTCCGGACCATTTTCG
TTCCCGGTGATAACCTCACCACAGCATGATGGCCGCCCGTCGCGCAGTGCTTCGGTGCTGGCCAATTTGCGCTCGACGAGGGCTCTGGAGACTTTGGAGG
CTTCGGACGACATCATCCTCGGCTCTGGCCAGTCGTCCGAGGTCCCCAAGGTCTCCACATCTTCGGTGGCTCCCACCAGTGGTGGCGTCATTGCCCCAGT
TCCGGCCATTGGCGTTGTGTCGTCGCCCGCCGTCCCGGTGACCTCGGCCGGCTCACCAGTTTCAGCGCCACCCTCGGTGTAGCGGGGCTACACAGTCGGT
TCACCTCCTACCTTAGTGCAACAAGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAAGGCATATGACTGGTAGAAA
GTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAA
CCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACT
TAAGTAAACTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGT
CCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCT
GCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAA
CGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCC
ATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAGTTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACT
GCCATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGAC
TCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAAAACGAGTTCCGATCGAGGGCGGAGTT
CCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACA
AAGGTCGTCACGTTCATGAAGGGCCTTAAAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAA
TGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGGCTAATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAAT
GGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAG
TGCACAGCACCTGTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCC
TGCTGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAG
CCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCC
TTCCAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACG
CGTACGCTTCTCTTACAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCAC
GGCATGATCCGGTGATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAACAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGC
ACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCCGATCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGA
AATGTGAAACGAATCAGCAGGGCCTGATTCAATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACA
ATTTGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCG
CACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAAAACCCGC
CGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGTAAGCGATCAAAG
CTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAGTGTCTTGACGC
GTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTT
CGCTCGCGACCTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCTGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCT
GAGGGCGCGGACGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTG
AGTACAAGGATGTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGT
CACGCGACAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCAAAGTCCCCG
CACAGCGCGCCTACGTTCTGTGTCAAGAAGCCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGC
CGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGA
GAGTGATATCCCTCTCACGGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAAC
AGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGTAAATCGGACG
TACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTT
GGGTGTCTCGTGGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAATGTAAAGGAACTGCAGCAGTT
CCTTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGG
ACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGT
GCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGC
TGAGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTC
TACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGG
TTGAATACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGT
CAGGACGACTACACCCTCGTCGTCCTTGTTGGACGACGTGAAGGCCGCATACGCACAGGATGCGGATGCGAAGCAATTGTTGGAGTACTTCTCCACACCT
TCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAA
CGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTATGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAG
ACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTG
CGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAA
GCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTG
TTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTACAC
TTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAACCGCGTGCTGGTTGACACCATGAAGAGCTA
CGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTG
AATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTATCTCCTTCCTTAAGTGGGGGAGGATATCCGGTTAATTCAAAACAACCGGATAAGC
ACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAGACAGTGTCTACGACGGGCGTAGACGCTTT
AAACGACAACGAACATCACGCGCAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGC
CGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCTAAATGCCGATAACACCGGCAAGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTG
TTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATG
GCAACGCGTACACACTGGACATACCGTCCAGCATACGCTTGCACCCAACGTTTTACGTTGGGCGACTGAAGCCGTACGTCATCTACGTCTGGTGACTCGC
CAAAGCGCTCTCGAGCGCGGCGACGCGCTTCAAGGCGCCAGAGAGCCTCGTCCCGACCTCAACCTTTACGTTCGAGGTCGTCTGCGCAACCTCCGCGAGC
TGAGCCTTCAACAAGCTCAGCTCCTGACGCAGAGCAGCGAACTGCGACGCATGGAGACGCTCAACACCCTCCAAGCGAGACTCAAGGTTTGGTTGACCAA
ACCCGGGGCGTCTTCCCCCCCCCCCACCCCACCCCCGTTGCGAGACGCACGCGGGGCAACTCGCTGGATCGTCCAGCGAATTGTTGGTCATCGGAACCAG
ACCCGAGGTCCGGTTCATTTTCGTATTCGTTGGATGAGGGTTTCCTCCCCAACACGATACGTGGGAATCACGGAATGTCCTGATGGAGGACATTCCGGAA
ATGGTGACGGCGTACGAAGGCCGCCACCGCCACCTCCGCCGAAAGGCGTAAAACTTGGGCGAGCGCTGTAGTCGCCTACAGCACTCGGATAAGTGCTGCG
ATTATCCGCAGCACTAGAAGACGCCTGCGCCTGAAAACTGGCGCGCAGGGTCTTGAGGTCATCAGGTACACACATGGACGTGTACCCGTTGACGTCCCGC
TCGGTGATGCGTACTGCTCCGGGGTAGCAGTACTCACAAGCAGTGTCGTAAGGCACTGCGCAAGGAAGTCCAATCCCGACTGCACCATGGTGCAGTCGTT
CAAGTTTACCACGCTTCGAGAATTTCTCGTAGCGCTCCCGCGCCTGGCTAATCCTGTCGCGATAGCCAGCGGGGTTCTTGTTGAAGTTTTCAACAAAGGC
ACTCCAACTTTGACAAAGTGCCTGTCACTCGGGCACTTTGCTTCTGCGAGAAGTCTTCTTGCTCGCAAACCATCGGAGCTCATGGAAGAGCCCGAT