Description :
From Genome Similarity Track
Location :
Scaffold_78:99022- 101986
Sequence
2964 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAGCGACCACAACCACCTCATCTGACATGAACATGTTGGATGAGGAGAATAGCTTTCACGCCACGTG
TGAAGGCTTTTCCCATTTGAGTGACATCGAATGGAGTGCGGTAGAACGTATGAGTTCTACCGTAGGCGAAACCGCCATTAGCGCCATGTTGGAGTCTCTT
GACAGAGACCAACAACATGCCGCTATAGCCAGGTTCATTCGAAATGAACTTGTCTCCGAAAGAGAGAAAGTAGCCTTGCTTGGCCAGCAAGGCTATCAAT
AGGTCGAGCAGTTAAGAGAACTCGGTGCTCAACAGACAGAGCTGTTGAGACAGCAGCAATTCAATGCTGCTGTGGGCGGGACGAAACACACGCGTCGTCC
CGAAATCTTGAAGGTTGACATCTCCAAGTACAGAGGAGTCGAGGAAGACTCCCTGTTGTTATGGTTCGTCGAACTAGACAGAGACATAAAGGCACGTCGT
ATCGACGATGGGCAAATGAAACTCACATTTGCTCAAGCCAACTTGGCGGGACGTGCCAAGACTTGGGCCTTAGGGCTGGAGGTGAGCGACCCATATGCTT
TTGAGTCGATGGAAGCCTTTAAAACTCGACTTAAACAGACGTTTGAGCCGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCTGAAAATCAAGCAGGG
TAAGCGTGATGTGCACGCTTACGCTCAACATATACGACTCTTTGCGAGTAGTATAGTTGCTAACCCAGTACATGAACACACGTTGATTACTGTGTTCATA
CAAGGGCTCGTAGATGGGCCTGTCAGTAACCACCTGTTCCGCTTAGAGTTGGATACGCTTGAACAAGCAATCTCAGCTGCGGAAAAGAAGAACTTTAGCA
TGAGACAGGATCATGCTAGCTCGCGTTCTTATCGTCCACTGAGACGACAAGAGACTGGAGGTCCAGAACCAATGGACCTCTGTTATTTCGAGAGCGAGAG
ACCTCGCTCTTCGAACAACAAGCGATTGCAGAAGTGCAATCGTTGCCAGAAATTGGGACACTACGCTTACGAGTGTAGTGCTCTACGCCCAGTACCAAAC
AGTACAGAGCGAAATGATCGGCCATTTGCCAGAAAGGACAATGGACGTAGGTCTGACGCTGTTGCGAACCGCAACAGCGAAGTGGGCCATCAAAAAATGG
TCGGGGTCAGTAGGGGCGGAGAGCCCTACTGATCCAGCAACCTCAAAAGAATTTGCAAATCTCTTGACGAAAGTTGCTCCAGATACACAATCATTGTGTG
TCTCTGCACCTGGTGATGAGGTATCACTCATTACCTTGGAATTGAAAGTGACAAATGATTTGTCACTTCATGCTCTAGTCGACTGTGGGGCGTCGAACAA
TTTGTTCGTCGTCAGTCGCTAGAGGGTCATAGGCTCAAGTTCGTTGAGCGCTACATCCCTCAAACGATGATGACGGTGTGCCTTGCCACATGCGCTTCGA
TAACCGTTGAGAAACGTGTACTAGGAATTCACTACACGTTAGAGGGCGAACAGTACACTGATGATTTCATCGTACTGGATCTGGATGACAAATTTGATGT
CATCCTGGGATTTCCTTGGCTCACAAGGTACGAGCCAAGAGTGAGCTGACAGCATCGATCCGTGAAGATGCCTGCCGCTTGTTCATCAGATGGCCATCTG
ATAAACGTCATGGAGCGTCCACAGGCGTGTGGATGTACTGCGAGTGAGTGCGATGGCCTTACTTGCGGTACGGTCGTTAGCACGACTGCACAAGACCTCA
GTGTAGCTAATCCCTACATTGTGGAGCAAGCTCCCGGCGGCTGTACAGAAGTACAGGCAGCGCCGAAGGTCCACCACTCGAATGAGTCGAGTGGACCGGG
ACATGGATGCATGCCTAGCGGTCAACATCCTAGGAAGAGGAAATCGGTTGCCACCAAAGGGAAACACGGTCATCCTAGGTCGACTGAAGAGTCGCTCGTA
GAGGATCAGTACCTGACTGTGGTTGCACAGCCACAGTCAGAAGACGTCGAAGGAATAAGTCCTCACGTACTTGAGGAAGAAATTCCTCAAGAAGTTATTA
GTGAGGTAACGAGACCTCATCATCCTGAAGGGAATAAGTACCCAGCAGCCTGTGGAAAAGGGTTCCCAGGAAGAAACCAAGACATTGAACGTCTTGGTCA
ATGACGGATCAAGCGTAGGCGCTTATACGCTTGATCTGGTTGTGCCTCCGAAGTTAACTTCGGAGATAACTCAGTTTCCAACGCAGGAACCGAAACGGTT
CCTGCATGATCTGCGTAGTGGCAAAGTCAGGCAGATCTGCATACTCGTCACAGAGGATGAGTATGTAGTCGATATTCGGTCGGCAACAGTATTTGCTGAG
AACGAACGGGTTCTTAGCAGCTCATCGATGGACAAAAGTGTCCTAGATGAGAAGACTCGGATTGAACGATACACGTCTCTATCCCGGGGGTTCGCTTCAG
GCAAATCCTTTGTATAAGGATTTGATCGAATTCAAGGATGTGTTCCCTGAATCCGTGCCATGCGAGTTGCCAAAGGACAAAGGCACTCGACACGAGATCG
AGCTCAAACCGGGCTCGAAGTACTGTGTCATGATGGAGTGGCCACTGCCTTGTGAACAAGTACTAGCGATCGACAAGTTCTTTGCCGATCGCTTTGCAGC
GGGCCATGTGAGGGAATCAACTTCCCTCACAGCTCCCCAACCTTCTGTGTGCGAAAGGCCACAGGAGGGTGGCGGATAGTGCACGCATTCAACAAGTTGA
ATGCTGCAACGGTACCGGCTTAGACGCCGATACCGAGGAAGGACGTAATCATAGATGGTATGTCAAAAAGTACCATCTTCTCGTCCATGGATATGATGGA
TGGCTTCTATCGGATCCTCATGCGTGAACGGGACATCCCGTACACAGCAATGAGCACCCTGGAC