Description :
From Genome Similarity Track
Location :
contig_6:990079- 992175
Sequence
2096 bases(100 bases per row)
GGACGCAGGCAGAGGTTGGAGCAGCCCTTGCGGGAATTCAGCCATCTTCGTCTTGCCCACAAATACAGACAGCAACCGCGTGTGTGTTGTGGCAGACACA
GAGCTAGAAGCGTCCCAGCTCACGATGGTCGAATTGTACAGATGAAGCATCACTAAATTCTCGAGACGCTGGAAGTCAGGAGGCATCTCTAGCTCTGGGC
AATGAACAATTGCCAGCGTAGCAAGAGCATCATGGTCCAGCTTATCAAACGACGTCTGGTCTGGCGTGGTGGTGTTTTGAACATGGCAATCATACACAAG
ACTTGAGCACGGTTCTTTGCCATTTGAGAACCAGGGTCGAGTAACTGACAGACATCCGACCATTTCATAGTTTGCTGCCCGCTGCGCTGCCAATCCGTGA
AACAAAATGATGATGGATCCCCAAAGCACGAATACCACGACCACAGTGATGTGTTTCCACTTCTGCAGAGCAGACTCTACTGGTGACTTTTGATCAACGC
TAAGCTTTTTAACCTGAGCAGCATTGCCGTCTTTCGGTCGCACAGCTACTGTCTGCATCACCCCCGCAATCACCTTCACATCACCGCGTCCAAGAAGCTC
GCTTACGGTGACCAGAGATAAGATAATGCTGAGTTGTGGAATGAGTTTGGTTCCGAAATCAAACAGGCTCGACGCAAAGATCAACCGATTCTCCAAACCA
TTGCAGAGAGAGGAACGGGCTCATATAGAAAGTCTGGGTTCTTGAAGATGCTATACTCGAAGTTGAATGTTGTAACATAAGGAAGGAAGATACTCAGCGG
CACGGCGATCATCATGCCGAAGCTGATTGAAGCGTCGTATGTTAAGGTGATCACTCTCTCCAGAGCTGGTGACTTTCGAAGAAAAAGCTCGATCGCGGCG
GTCGTCCAGCAGTTCGTGATTAGCAACCCAACAATGATTGAGTTGAGACCGGCACGAGGCAGCAAATTGCTAGCTCGATAGGCTTGGTATGTCTGTGAGC
TAGCTTCTAACAGCTCGCGAAGCGCAAAAACAGTCGAGAAATGCTCGCTTTCGACCCCAAATATCCCTTGACGCGAGAAAACGTTGTTCCACATGACCAC
AAACGGACCAGCGAACCGCAATCCCGACGATCCTGATGATGAATTCTGCACTACATCTTTAGCAGACTTGTCTTGGCGACTGGACATTATTCCTTTCGAC
GCCAAGGCTTTGATTACGCTTGTATCTGATCGGAGCGTCAGTCGTCGAGCCTGGATGCTCATTTCGAGGATACGCAGAATCTGAAGTCCATGCATACCAC
CAACGATGCCAAACACGACACCGTAAAAACGATAGTTCTGGATGCCTGTCAACGACCAAATTGAAACGTAGAACGGCATGATCCCTTTCGTGAGGTACCA
ATAAGTCATCGCGGCGCAGATGAGGTAAGCGCCGCAAACCGCGTGGAATACAACGATGAACAGCCATGCCGCGCTGTACAGAACCGGCGACAGCTCCAGT
ATCAGCTGAGGTGCACGCCTTGGGCTGCCATTTTTCTGCTGGAGAGAGCTCATCTCGAAGCCCGGGGTCAGCTATATTTCCCGAAACCTTTACCTTGTTC
TGCTGGTGGTTGGACTCTGAAATCACGTTTACAAGTGCGACCAACTGTGGTCATAACATGCCAGTCTGCTGGTCTCCATAATAGACTGCGCTGGACGAGC
CCAGAATACACCACCAGAGGTTTTTGAAAACCGCCTTTGGTCGGCCATACGTGTAGGCACTGCGCCAAATTAAGCATCTCGTTCACCAAGACAACTCGGA
GAAGTGCGGATCGCCGCATTGAGATCATTTGTTGCGACAGCTCACAAGCCCAAGCACCTGCTGGACCAGAAGCGCCAGGAGGCGACAGGCGGCAATGGCC
TTGATCATGCCAAGCTCAACGTCTCGACCGGGCGCACCTTCCACTGGAGGCTGCGTTGACGGCAAGTACAGTACAGCCAAATGTGTGTCGTGCCGGCCAA
AAAAGGCAACTTCCAACTTGCCTTTTAGCTTCAAGGCTCGGTCCGACGCTTGCTTATTCCATCACGCGGCTCCGTGTGACTGGCTGAAATGTTTGC