Description :
From Genome Similarity Track
Location :
contig_6:990056- 992126
Sequence
2070 bases(100 bases per row)
TCATCAGGGACGCAGGCAGAGGTTGGAGCAGCCCTTGCGGGAATTCAGCCATCTTCGTCTTGCCCACAAATACAGACAGCAACCGCGTGTGTGTTGTGGC
AGACACAGAGCTAGAAGCGTCCCAGCTCACGATGGTCGAATTGTACAGATGAAGCATCACTAAATTCTCGAGACGCTGGAAGTCAGGAGGCATCTCTAGC
TCTGGGCAATGAACAATTGCCAGCGTAGCAAGAGCATCATGGTCCAGCTTATCAAACGACGTCTGGTCTGGCGTGGTGGTGTTTTGAACATGGCAATCAT
ACACAAGACTTGAGCACGGTTCTTTGCCATTTGAGAACCAGGGTCGAGTAACTGACAGACATCCGACCATTTCATAGTTTGATGCCCGCTGCGCTGCCAA
TCCGTGAAACAAAATGATGATGGATCCCCAAAGCACGAATACCACGACCACAGTGATGTGTTTCCACTTCTGCAGAGCAGACTCTACTGGTGACTTTTGA
TCAACGCTAAGCTTTTTAACTTTAGCAGCATTGCCGTCTTTCGGTCGCACAGCTACTGTCTGCATCACCCCCGCAATCACCTTCACATCACCGCGTCCAA
GAAGCTCGCTTACGGTGACCAGAGATAAGATAATGCTGAGTTGTGGAATGAGTTTGGTTCCGAAATCAAACAGGCTCGACGCAAAGATCAACCGATTCTC
CAAACCATTGCAGAGAGAGGAACGGGCTCATATAGAAAGTCTGGGTTCTTGAAGATGCTATTCTCGAAGTTGAATGTTGTAACATAAGGAAGGAAGATAC
TCAGCGGCACGGCGATCATCATGCCGAAGCTGATTGAAGCGTCGTATGTTAAGGTGATCACTCTCTCCAGAGCTGGTGACTTTCGAAGAAAAAGCTCGAT
CGCGGCGGTCGTCCAGCAGTTCGTGATTAGCAACCCAACAATGATTGAGTTGAGACCGGCACGAGGCAGCAAATTGCTAGCTCGATAGGCTTGGTATGTC
TGTGAGCTAGCTTCTAACAGCTCGCGAAACGCAAAAACAGTCGAGAAATGCTCGCTTTCGACCCCAAATATCCCTTGACGCGAGAAAACGTTGTTCCACA
TGACCACAAACGGACCAGCGAACCGCAATCCCGACGATCCTGATGATGAATTCTGCACTACATCTTTAGCAGACTTGTCTTGGCGACTGGACATTATTCC
TTTCGACGCCAAGGCTTTGATTACGCTTGTATCTGATCGGAGCGTCAGTCGTCGAGCCCGGATGCTCATTTCGAGGATACGCAGAATCTGAAGTCCATGC
ATACCACCAACGATGCCAAACACGACACCGTAAAAACGATAGTTCTGGATGCCTGTCAACGACCAAATTGAAACGTAGAACGGCATGATCCCTTTCGTGA
GGTACCAATAAGTCATCGCGGCGCAGATTAGGTAAGCGCCGCAAACCGCGTGGAATACAACGATGAACAGCCATGCCGCGCTGTACAGAACCGGCGACAG
CTCCAGTATCAGCTGAGGTGCAAGCCTTGGGCTGCCATTTTTCTGCTGGAGAGAGCTCATCTCGAAGCCCGGGGTCAGCTATATTTCCCGAAACCTTTAC
CTTGTTCTGCTGGTGGTTGGACTCTGAAATCACGTTTGCAAGTGCGACCAACTGTGGTCATAACATGCCAGTCTGCTGGTCTCCATAATAGACTGCGCTG
GACGAGCCCAGAATACACCACCAGAGGTTTTTGAAAACCGCCTTTGGTCGGCCATACGTGTAGGCACTGCGCCAAATTAAGCATCTCGTTCACCAAGGCA
ACTCGGAGAAGTGCGGATCGCCGCATTGAGATCATTTGTTGCGACAGCTCACAAGCCCAAGCACCTGCTGGACCAGAAGCGCCAGGAGGCGACAGGCGGC
AATGGCCTTGATCATGCCAAGCTCAACGTCTCGACCGGGCGCACCTTCCACTGGAGGCTGCGTTGACGGCAAGTACAGTACAGCCAAATGTGTGTCGTGC
CGGCCAAAAAAGGCAACTTCCAACTTGCCTTTTAGCTTCAAGGCTCGGTCCGACGCTTGCTTATTCCATC