Description :
From Genome Similarity Track
Location :
Scaffold_94:9900- 13990
Transcript NameFunction/comments
Phyta_totarag3428sulfite reductase [NADPH] flavoprotein component, putative

Sequence
4090 bases(100 bases per row)
GTCCAGTGAAGTCAACCAATGTGCTAAGGAACTAAATGtggagcttcttgatgtgcctcctgcaccacctccgtctGCCAGCCGGCTGATGCAACGTGGA
ACGGGCCCCTGAAGAATCGATTGCGTGCAAAATGGGTGGGGCTCTTGCGGGAGCAGCTTTTGATGAGGGACAAGGCGACGAAGTTCAAGCTAAAGCCTCC
TACACGACCGATGATATGCTACTGGGTGAGTAGTGCTTGGCGGGATATGCCCCCTTCCATCATTTCGAGTGGTTATCGGAAGTGCGGCTTAATGCGCATG
CCGGAACCTGAGTTCGCTACAGATGTAGTGCGAGAGTTGAGCGAGTTGGGCTGTGTTGACAAGCGTGCGGGAGAGATTCGACCCGATCGAGACTTTGAca
tcgacgaggaagaggaagattAAGAAGCGCTTGGACTCCGAGGGTGTCAAGTTTAGTAATATACTAAACCTAGATGGGATCGTTCAGTCTTGTCATTTTG
TGAGCATAATTAGTACTCCGGCTTCGCTTGCCCCGAAGGGTGTATCTCTCTACAAAGCATATTCGGTAGTAGAGCTATTGAGACTCGACTCCGGAGTGAG
GGTTATTCGCACCAAAAATATGGTGTCAATGTGTCACAAAAAAGTGTAGCTCCACCAAGGGCACAGTCAGgaccacacacacacacacaaaacaGGCAAC
CCGAAAGTGTACCACCACCAAGGCAAAATACACGGCCACCAAAATAGAGCTTTAGCTTCAACATGTTGCACTTATGCACTTATAATTGGCAATAGACTGC
TACGTCCGCTTCAGTCTCAGGCGACATTCATTTCCCTAAACTTGCGGGCTGGGAGACGGTGGATGACGTCAATGAACGCGCTGCGTTTAAGCAGGTGGCA
TCTCGCAACATTCAGCTTCTGGTCGTGGACGCTAACGAGCTGGTCAGCcgcgtggaggacgacactgttgctgctgtgggtcTGCAGACGGCCTTCTTCG
AGGCGTCGGGCCTGTATGACGAGAGCGTGGTGCTGACTCTGCTGGGGGTGCAGTTCCCTGAGGAGAAGCACGCGACGCTGTGCTCGTTCGTGTCCGCCGT
GCGGGGGGGGCGTGTCGACTTTCACGTCCCGTCGAACGAGTAGCTGGCTGTCACggatgtggacgaggaggcagCCGCTCCTAAGCCGCTGACAGCGTTC
GCGAGCGTGGCGACGAGCAAGGTTCTGTTCGCTAGCAGCGCCGAGTCGACGGTCTCCAAGTCTAACGGCAAGCGCCGGTCGTACGCGGAGGTGTCGCGCG
AGACCAAGACGGCGTGGCTGCTGATGTACCCGAACGCGTTTGAGGCTCGTCACAGCATGCGTGACCACGTGACGGACCTGGTGACCGTGACGAAGTGGGA
GCGTCTGACGCCGGAGGACTACTCGCGCAATGTGTTTCACATCGAGATGAACACTACGAACACGGCGATCAAGTACCGCATCAGTGAGGCTTTGGCTGTG
TTCGAGCACAAAAACGAGAAGGCGGTGGTGAAGTTCCTGCAGAGGTACAACGTGGACCCggaggcgctggtggcgttgccTGTGGcactcaagaagaaga
agaagggcgagGCTGCCACGGACCCGAGCGAGGAGACGTTGACGtacttccagctcttctcaCACGTGCTGGGCACCTTCGGCCGCCCGTCCAAGAAGTT
CTACCAGGCTTTGCTGGAGCGTGCcacggacgagaaggagaaggcgacgcTGACGGCTCTGTTGGATGCGGATGGCAAGGACGAGTACAAGCGTCGTGTG
GACGGATGGTGACGttcgcggagctgctggaggagttCCCGTCGGCGAGACCGACGCTGGCGGATTATGGCAAGTTGAGCTCAGAGAGTAAGTTGCGAAG
TGAGATTGATGTAAGTCTAAACGTGCACTCCTACCAACGAGCCCCTTGTGGAACAGCCCTCGTACTTGAGCTTGcttccttcacgctgctgctcctccaa
TAGTCATCGCTACCAGCCACTCCTGGCTGCCGCTGCGTGCCGCTCGCTCATTGCTGTCGCTACCTCCCGCTCGCTGCCTCCACAGCACGCGCCTGGGCCT
GTCATTCACTGGGGGCTCCTGCACCAAGAGATCAACGCAGAGATTGGCGCCGGCATCGGTGTCGCGATTAGCACCGGGATAGGCGTCGAGATCGGCCGCC
GCTAGCACCGCAGTGTCGTCTGGATACAGCGCCCTTGCAGCGCTCAACACGGACTTGCTGACGCTTGTCAAGCCATGCCACTACTCGATCACGTCGAGCA
TGAAGATAAACTCGACGAGCATCCacctgctggtcgtggtgcaCGACTGGACTACGCGGAGCGGCAAGTACCGCATCGGCCAGGCGAGTCGCTTCCTGTC
AGGTGTGAAGGTCGGCCAGAAGCTGTCCATGTCGGTGTGCTCGtcggtggtgaagctgcaggcgaaTCCCGAGGACCCGATCGTGATCTCGGGTCTGGGT
ACGGGTATGGCTCCGTTCCGCGCGTTCATTCAGCAGCGCGCGTTCCTGTGCTCACAGGGTACGAAGGTGGGTGTCGATGGCGCTGTACATCGGTACTCAC
CACAACACCAAGGAGCACATGTACGGCGTCGATCTGGACGCGTACGAGGCGGGCGGTATGGAGACGTACCTGCGCGTTCTCGCGTGATCAGGAGTACAAG
GCGTATATCCAGGCCAAGTCAGTAGAGGAGTAGTGGACTTACAGCTGCAATTCAGATCGTTACGGTGAATAGATATTGAGTACGTCGCGAATGATTGTGT
ACTGTGGCAACCATGTACTGCGTGGATACGGGTGTAGCAAGTCGCTAGCTTATAATTAGCAATTGTCAGCCCGTCGTGACAGCTCGGCGTGGTATCCGGG
TATGTGGACATTGCCATGTTTGTGTGTCGGGATGGCTCCGAATTGACTGGTCTACGTGTGGTCACTCCACTTCCGCTTTTAGTGTGCCACGTATGCACGT
TTGAGGTGTACACGTGCTATATAATTGGTGACGGACCGCAACTCTTTGGTGCTCCTACACCGACCTCCACGGAGACGTGACCGAGCTCCCCGAAAAAAAG
AGAGCCCCAGTCCCCGTATCAGTTTGAGGCTTATGTCAAGCCACTTAAGAACAAGCCGTGCTTGCGCTCTGTATCAGATAGTACGGTCTTATCAGTTTAG
TGACATTTCACTATAGAAAGAACATTATTAAATAGAAGGTGTTCCTCGGGTGGCTGCTCGGCCTTTGGTCGGGGAGAGACCACCACTTCTGGATTTCCCC
TCCAGCCCCCAAGAACCTCCtcagcctcttcctccttcgtcgCAACCAGTTTGATATActggtagcacttgttgGCCAAGGCTCAAGCGACCATGGCCCG
TACGACACGCCGCCCGTGGAGGGAGGAACCCAAGCCGAGCTAGAGAAGCAACTAGCCCAGCCAGCTACGCGCTGAGATCACCACACTTCAGGCCAACAAC
CGAGCGCCTCACTCGACGACAACTGAGTCCAAACCTCTAGTCCCGAACGGCCTGCCCAAGTTCAAGGGGAAGCCTGATGAAGACGTGCGCCAGTGGCTCT
TCCAAGTCGAGACACTGTGTCGCATCCATGGCCAAGACGCGACGGACGGTAGCGATGTGTTGCCTGCTATCGGCAGTACTGCTATGGAGGAGAACGCGTC
CGGGTGGTTCCTGTGCTGGGCTTCAAGGACGCCAGCGGAGGAGCAGACGAGGAGTCGGTTCTCTCACGTCGCCCTCACACACTTCGACGCCTCCTACTAT
CAAGCAGTGCTGCGGCGAAAGCTTCGCCAGTTGCGTCAAGTCAGCGACATCAAGGGGTAGAATGGAAAGTTCTTGTCGCTGATCTTCCGTGTCAAAAACA
TGAGCGAGGTGGATCAAAATCAGCTACTACTGCGACAGACGCAAGCTACTCTCCACTCACTCCattgctcctgctgctcacgacCAGTAGCGCCGTCAGT
TCTGTTCGAGACGCAAATTGCGGCTGCTGGGCGTACTGCGGCTACAACGCCGATACACCACACCATGACCGACTGCGTCAGCCATTAGAC