Description :
From Genome Similarity Track
Location :
scaffold_1379:99- 3911
Transcript NameFunction/comments
g11346.t1hypothetical protein

Sequence
3812 bases(100 bases per row)
CAAGATTGAAATCCTGGATCACTCGTTTTGACCTCTATCTTCTCTTCGCGAGTTCGATCCGGGGCCTGATCTGACATGCTCTCACGTATCCCTCCGCCCC
CAGCATGGTCACTGAGGGTCCCACGTGGATCGAATCCAGATTGCTTCTCAGATGTATCGCCTCCGTCTGAATTGAGGAACGCAACTCGGATCTTGCCGCT
GCCGGCCGATCGCACCTGTGATCGAACCTCTAGATTCGATATCGATGAGGATTCGTGGTCGATTTCGGTTGTTTCGCCGCGGCGGAGTATCGATCTCGGT
GTAGCGTACGTTGGGCGTTCGCTCCACGGGCCCTTCCGGGATCTCGGGGGTTCCGATCGAGCTTCGACAGTGGCTTCCAGTGCTAGATTCTGCCACTCCA
TGTAGCGGCGAGATCCCACTGACACGAAACCTGGAGATCTGGGCACTTTCTCTTGATCCAGTACCATTCCAACATTGAGACGATGATCTAGCCTCAAGAT
CTTCTCTCCAAGATTCGAGATCACGAGATATCGAGTTCGACCTGGACCATCCACCACCGTAGGTACCCACTGTTCTCCTCTGGTTACCCACAGCTTCTCC
GTAGCACCCAACTTCACTCTTGATGCTGCCTCCTCCGATTCCCCGACTGGTATCTGCAGATCTTCCTCGAGAGTGATCGATCGCACCTTGTCACCGTACA
ATCTCTTGCGACCGTTAAGCGGGATCCCGACTTCGTCGGGTAGACACATCGACCCCTTGGCGAGATCCATCCGGACCCCGGCCGGAATCATGAAATCCAT
GCCCAGGATCGCATCCTGGCCCGAGAGATCGCCGATCCATATGTCGAAAAAGTAGACCAGATATCCTGCCAGCGTGATCTTGATCCTTGTTCTCCCTTCT
GTGGTATACACGTTATCGCCAATTCCCACATATTCCTGTCTCTGACTAGTGTCAAAGTGGCACCCAACCTTACGAGCAAAGGTGGTATCCAATATAGATA
CCTCGGCTCCAGTGTCTAGGAGCAAGATCGCCTTCTCATGATTGATCTTGCCTGTGATCTTGGCTTGTCGGAACCACTTCCCTGGTGCATGATATTTCCA
GTAACCCCGGGATTCTCCATTCTTGAGATCCAGGGCCACCCCTGCATCAGATCGGCGGAACTCATCGATCTTAGGTAGACTCGCGATCTTGGCGGTGTAT
GTATGCAAGTCACATGTATTACCGCGTAGATCAGACTCCTCCCTACCTCGATCTGCCGACGTCTTGTTCACGTATGCGTAGATGCAGTACCTAGAACGCT
CGGCTCGTACCGGATTCCAACCCGGTGAGCGTCCTAGTTTAACATCTTTTCCACCTTCTCGGGAAACATCCCTGCATATCGAGTCGGATCATACCACTGG
CGGATCTGGTTGTAGAACTCTTTCATGATGCATTCCCCGGCTTCGTGGACCTTTCCACAGCCACGGCACACATGTAGGCAGCGATCCGTCGGGTGACCCC
TCTTCCCGCACTTCTCGTAGGTCGATCGCTTCCAGCAATCGAGATCCGTGTGTTTCCTGGATCCACAATGCGAGCATCGACCTCGATCTTGGTGATCACG
ATCGGAATGGGTCCGGTGATCGGAGATCCGGCCTCGATCTTGCGGGTGGGACCCGCCCCCAGCACCGATCGATTGATCATCAGCCGCGGCCAGGTAGAAC
TTTCGTAGATCTCCTTCAGAGTCGGACCCATCTGATCCGGACACCCCTTCTGACTCTGAACTCGGGTCTTGGGCCTGGATCGCGCGCACTACGGCCCTGG
CGGGTGCCGTGGGCGTTCTCGATGAAGTCTTCTGTCGATACTTCGATCCGAACGCAGATCGTCGCTGTCGGCTCTTCGCTCGTTCTCGAGCGCGGAGAAT
TTCCTCCCGATCGTCGACGTCAGTCAGTCGAAGCAAGGTCAGGCGATCGGCCAGCTCGGGATCACCCAAAGTCTCGATGAAGTGATCGACGTGTTCCCGG
CGGGCCTTGGGATTTCCGTCCTTGATCTTGAGTTTGGCTCGCAGAGCCGCCACATTCAGACGATAGAGATAATCGAGCGGGGTTTCTTCAGATCGCTTGC
GCGCATGGTAGTATTGCCACGCCACTGACATCTCTAGACCACAGTACTGGGTCTGGAAACTGTCAAGTAGATCTGCCCACTTGGTCTTGGTCGTTCGACT
TAGTTGTCGGTACCAGTTCTTCGCCGGACCGATCATGAGATCCGCGAAGGTGAGGCATTTCTCCTCCTCGGTGGCTTGATCTCGCTGGAACGCGGACTTG
ACCTTGATGATCCAGGCTCGGGCGCGATCTTCGTCGAGATCCTTGCCGGCGAACTCCTTTAGATCCGAGATCGCCGAGATCCGGACTCTCTGGATCATCG
ATGTTCCTCCTTGCCCGATCGCGGCTGTGGCCACAGCCGCCTGGCTCACTGTTGCTCCAGCGGGACTTGAGATCCCAAGATCATCCGGGTCATATTCCCA
CGAGTGCTGATCTGGGGTCCCGACTGACTGCATATCGACATCTTGCGCCCCCATGTACTTCGTGTGTGTGTGTGTGTGAGGAATCTAGGAGTAGCTAAAT
TTTGCTTCTTCAAGAACCGATTCATCGCCACATGGAAGTATTCATCCAACTTGCTGCTGGGTCCTGTCGAAGTGGTTGTCGGAGTAGCTTGATCTACCAT
GACCTGGCGATCTTCTCGTCGATCGGGTGTTCTAGCGACCGACTTCAACCCGACTGGTCGTTGATCTTGCTTCTTCATGCGTGTTCTCAACAGCTTGGCT
CCGGAGAGACCCAGCAACATCCTCGGAAGCTATCCGAGTCAGGCTCCGAGGTGACTGACGCATAATGCGAGGATTCGGTCTGATATCCAGGATCCAGCGT
CTGCATGCGTTCACCTACCAAGATCTTGAGGGCATCAAAGAGATCTCGGGTCGCGGACCGGATCGCACCAAGATTCATGTCAAACAGGGAGTTCGGATCG
AATTCTCCGGCAACCGGTCCTGCTTCTCGAAGCAAATTCAGCAAGATCTTCACCGCATTCAGTCGATCCGTGACGATCTGAGGATTCGATACTGGGCCCG
TCAGATCTCCGATCTGGCGGACTTGTATGATCACAAGGACGGGATCCTGGAGCAGGATCTCACTCAGCACCTTTCGGTAATACGCCTGCTCGATCGTGTC
CTTGGTGGCATTCGATCTCGACGGGATCACGTCTTCGGTTTCTGAATCTGGCGCCTTCAACTTCGTCCGGGTAGTCTTAATCTTCTTCTTCTTCGTCGAT
CTTGGAACAACCGTGGACTTTGTGAGCGGATTAGGTTTCGACTTCGCCGATTCCTTATCGCTCGGGTGCGGATCTCGATTCTCATCGAGATCCGCGGTGG
CCCCCGAAGGGGCCTTGGGAGGAATACGAGGTTTTTCTTCAAGATCTGGATCCTGATCCAGGTCCGCCTCGTGTCTGTCAGCAGAGATCCTCCCAGAACT
CTGCTGATCCGTGGATCTTGCTGTATTCAGCGGTGTCTTCGTCGATCCAACATTCGAAGACACTTGTTCCCCTTGTTCTTCTTTCACCTTGACATCTTCT
TGGGACTCACGGTGATATCCGAAGTCACCAGAAGATCCGGGCACGCGCACCATTGTGGTGGAGCAGGATCCGCTAAAATCTGGGTAAGGCAGGTCTCGAT
ACCACTGGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGACGACCCGTGATCTAGCTGTGTGTAGTATTCACCTTGTGTACCCGTCGGTAGGCGGGT
TTCGCTCTTCCA