Description :
From Genome Similarity Track
Location :
Scaffold_119:99- 2437
Sequence
2338 bases(100 bases per row)
TTGAAGGCAGGAGATTTATCCGAATTAGTGGCCATTAGACCCGATGTCGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGACACCAAGG
CGGCACTCAGTGCCCGAAGTGGATCTTCGATCCTTAAAGATCCTTTGGATCCATTCTAGCCTTTGGTAAAGGAATTTCAAGATGTAGTGTGTCACAACCC
ACCATCTGTCCTACCTCCCGATAGAGGTGTGCGTCATGAAATTGACCTAGTTCCAGGAACTAAATACTGCGTAACACGGCAGTGGCCTTTACCTAAGGAA
CAGTGTGACGTCATTGACGATTTCTTTCGTGCTAAGCACGCGGCGGGAATGGTGCGGGAGAGTAAGTTTCCCCATTCCACACCGACGTTTTGTGTCAAAA
AGCCTAATGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTTAGTGCTGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAA
CAATATGGTGGGATGTACATTGTACAGTGCGCTCGACTTAGTCGATGGTTATGACCAGCTGCTCATGCGAGCAAGCAATATTCCGCTAACAGCGGTTAGT
ACCCCGAGCGGTATGCTCTGGGGGTGGCTCGTTATGCCACAAGGGCTGTCAAATGCCCCGGCTACTTTTTTAATCGTCTGATGACGCAACTGTTCAGACC
TCATCGAGGCTATGCAAAAACGTACTTTGATGACATCTTTGTCCATAGTCGTGCAACGAACAGTCGATCTGATGTGGATAATCACATTGATCATTTACGA
GCGGTGCTCGAGTGCATGCACACGAATAAATTGTATGCAAATGCATCTAAGTGCAGCTTTGGGGCAGAAAGACTCCCTTTCTGGGGTGCTTCATTAGGAA
GCGAGGCCTTCGATCGGACCCCGCTAAGGTAAGGGCCATAGTCGATTGGCCGGTTCCAAAGAAATAAAAGGATCTACGTAAGTGGCTTGGCCTTGCCAAT
TACTTGCATAAGGATAGTGCGAATTACGCAGATATGGCTCGGCCATTATCCAATCTCCTGAAGAAGGATGTGGATTGGTGTTGGGGTAACACCGAATACG
ATGCTTTTCAAGCAGTCAAGGAAAGTCTCCTTCATGCGCCAATACTGGCTTTGCCCGATCCTGATCAGCCTTTCAGTTTCGTCTGTGACGCATCTGACTT
TGCCATATGCAGTGCTATGTTACAAACAAATGTCGATGGACGCGAACGCGTCATTGCATTCGAATCCCGACAGCTCAAAGCTGCTGAAAAGAACTATCCA
GTTCATGACAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTATATCTGCTTGGCTCAAAGCCATTTATGATCTATACAGATCATGTAT
CATTGCGCACTGCGACACAGTCGCCGCATCTCTCTCAGAGAATGGCTCGTTGGCTTTCATTCTTTGCAGAATATAACTTCGAAGTGAAGTATAAGCCAGG
AAAGCAAAATGCTTTGGCCGATGCGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACGCTGTCATCGTCGGTCACTGACTTAATCCGTGCG
GCTTATGTCAAGGATGAACAATGTGTAGCTTTGCTACGTGCTCTTGGGAGCGAGTCGTTTAAAGACTCGGACATCGAATTGTCGGCACGTTTGCGTGCGA
GGCTACATCGATATTCTATCGATAATGGCCTGTTGTGCTATCGCACAGATATTGAGGATAACCCTCGTATTGCTGTCCCTCATGATGAGGAGTTGAAGTA
TCGAATCTTCTATGAGGCACATGAAACCGCTTAAAGTGGTCATCTCGGTCGTGAGAAGACCTATAGCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTA
TACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTTAACGGGTGAAACCCTCAGCACATGCGGCGGCGCCACTGGCTAGTCTGCCTGTACACT
CTGGGTGTTGGGAGTCCATCAGCATGGGCTTTGTGTTTGGCCTACCGAAAGATTCGGAAGGCAACACTGGTATTGTGGTCTTTGTTGACCGATTGAGCAA
GTGGCTCATCTAGCGGCAGTGCCGGACTCTATTGATGCAGAAGGTACAGCAAAGCTGTTTATCAACCGTGTGTTTTGACAACATGGCTAGCTTGTCTCTA
ATAGAGATCCCCGCTTCACTGGGAAGTTTTGGAAGTCCATCTCCAAGGTGCTCGGCACCCGTTCGGACATGTCCACAGCGAATCATCCGCAGACCGATGG
TCAAACTGAGTGTGTTAATCGCGTCATTAATGAGATTC