Description :
From Genome Similarity Track
Location :
Scaffold_2071:99- 1443
Transcript NameFunction/comments
Phyra_87493C2 domain-containing protein, putative

Sequence
1344 bases(100 bases per row)
TTCTCTCGTTCTTACGCTGCATTCTTGCAACAAGGTGTAATATTACGTGCAGCCCCACGCGATGAAGGTGGTGAGGATCGTGCATCCCGTCTTCCAATGG
ATCTCTGAGGTCCATCCGAAATGGGCGGAAGGGAACAGTTTGATGTATCTGCGAGCTCACCCACGCCAGTATGGAGTCCGCTCGACCGACGAGCAGTGAG
TGATCACGGGATGTTACCGGTACAGTTTTGTCTATGTATTATAGTTGCTGCGCCAAGTTGCTGGTGAGCCACCAAAGCTGCAAATCAGTGGCGGGCCAGC
CTGATCAGATCCCAACCTGGATTATTGGACCCCCGCTGAGACGGTTGGTTGTTGTAAACATTCACCGAGGCAGTGGTGGATACGCACGCACCGACAGATC
TGGATTTCCTGCGTGCCCTGCATCGCTTCCCCTGCAACCTCTCTACCTCCATGGCGTCACCGCTGGACATGCCTGAAGGCGTCGTTCTCGACTTTGACGT
CGAGATTGTGGCAGCGAACGTGAGTACCCTCCTCCAGAGGCAAAGGTACCTTCTCGGTCTAACCCTAATGTATTGGCTTGTAGAACATCGAGGCCGGCGA
CTTCCTCGGCTGGACGGCAGCTCTCCGAGGTGAGCTATCGTCGAGTGACGCCTACGTTTCGATCGAGATCGACGGCGTGAAAGTGGGCTGGACACGACCC
ATCTTCGATACTCTCAAACCAGCTTGGAACGAGAGATTTTACTTCCGAAATGTCCGTCCGGGCTCCCTGTGCAAGTTGTCCTTGTTTGACAAGGACATGG
ATGCTGACGATGAGCTGGGGGCGGCGCAGTTCACGGTAGAAAACACGGGCGGCCAAGAGCTTATTTCCGAGCTGCCGATCACATTGGCCGACAAAAAAGC
AGGCGTCCTTGTTATCAGGGTGGGTCCGTCATGTTACTTGCCGTTTTCGCTCATAAGACTAACACCAATTTGCCCTCTTGTCGTTCTGCAGACCAAAGGT
ATTCCAGCGAATTCAGTAGACAACGAGCTGCTTCGTGAGGTCGGTCCTGTTCGTTACTCGGTGCACTCGAGCGTCGGCGCGGGGCTCTTGTCCATGCTGA
CGTCCAATGACGATAGACTCGAGTCGTTGGCGTATCGCGTCCAGCTCCACAATATCCCGGAGTTCCTACCAACAGAGCACGAGTGGAACAAGAACTACCC
CACGATTCAGCGAATCTTTTCGCCAGACCACCCCGAGTCACCCATTCTTCGTCAAGCGATCTTAGCGCAGCATGCCGTGGTCTACTCTCACGGCCCAGAA
AACACGCACTACGGCTCCATTTCGTCTCCTGCCGACTTCTTCAA