Description :
From Genome Similarity Track
Location :
Scaffold_1040:99- 1399
Transcript NameFunction/comments

Sequence
1300 bases(100 bases per row)
CAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATCCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCATG
TGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCATCCAGTCGATCACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATAAGTTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTA
CGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCT
CTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGATCTCTCTCATCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTC
ATCTTGCTTCTTGCCGTGAGATTGACTCTCACTGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGCGCGGGGCGCC
CTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAG
TGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGAC
CTCCCGACGGCCTTACCACCGGTCGTGGCATTAGCCGCGGGACGTTCACATGCAGTTTAGCCTGCCGTAGGCTAAACGCTTCTTGCATTGCGGGCGCAAT
TGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTCGTCA
ATCGGGTTGGTCACAATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCG
ATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTA
CGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCG