Description :
From Genome Similarity Track
Location :
Scaffold_346:9898- 13278
Transcript NameFunction/comments
Phyta_totarag7356hypothetical protein PHYSODRAFT_451952
Phyta_totarag7357hypothetical protein

Sequence
3380 bases(100 bases per row)
ATAAGGGACTGTCTAAGGAGGGCCATTTGCAACAGGCCATTTGCATAACGCGATCAGCTTGAACATAAGACTGACCTGTTCTGGCTGCTGAACGCACGTA
CTTCAGTAAGAGTCACATACAAAACTCTATATACAAGCGGGGCATTTCCGTCTCAAAACTGTATTCCCGTCTCATCGCCCTATACAAAACTCTATATATT
TCCAGACGTTTCTGTCTCAAGTGAGCATTCACGGCTCACTTCAGCAATGGTGTCCAACCGCATTCCCTACCCGAGGCTACCAGGTCGTGTACTTGGGTTT
GCACAATGACATCTTGGCAGCGCTCTGAAGCAAGCCGAGGACCGAGACTATGCGTCCGTATTCGAGGAAGTTGGTGGGAAGCACGATGACAAGTTCAGGG
CCCAGTCGCGTGTGCAGCCACACTAGTCGTCGGGAGCAATCAACGAACTCCGTCGCGCACTTCGTGTGTGCACCGCAAGCATGGATCCTGGATGGATCCC
GCGTGAATTCTCTTTCCTGCGGTCGATTCCAGGCGGAAAGGAGCAGGGGGCTCACCATGACTACACGACTCGTGTGGTTCGTGGCGCAGCAAGAGGGCGC
GCTCATCGCATCCCAGCCAGCATGGTGCTAGCACTGCAACCAGGCACAAGCTTGGGGGTTTACGAAGGCTGCTACGATGTTCGTGACGACTCCAAGGCCC
ATGAGGTGCACATTCCGGTGGGGTTTGAGATCATATTCTGTGGTAATCTTATTCATAATGGAATGCCCTACGATGCGGTGAATTATCGAATTCACAGCCA
CCTGACGTACGCGAAAATGAAGTGGGAGCCTGACATCGTGACCAGCGTTCTGCCGAAGACCTACAATTGCCAGTTCTGCGGCCTGAATATACTCGAGCGC
GGGCGAATGGGATCGCACCGGTTCTATTGCATCAAGAACCCCAAGGGACAAGAAAACAGGAACAAACGCAAGAACGAAAACAGTGCAGGTAAGATTCGAG
TCTGTAATGTGTGTTGGAAGGGATATACCAATTCGAGCTCCTATCGAACTCACATTTCGCGCCCACACAAGAACCTGTAGGCTTAAGAAAAGTGAATTGT
CTTCAGTCAACACCAAAGTTGAATACAAGGTTGGACGCCATTTCAACTTAACCCCCTTTTTGCTaaatgttgaagttgaagttgaaatcAGAAAAAATAT
CATTGTTATTAATGCACGGTAAACGCAAAACCAAATACGGTAGGCCATCAATCTGCTCACACACTCCATCCAGCGTACCCCGAAGATCATGGAGGGGCGA
AGTGCTGCTGATAAGCAGGGCTGTCGTCGGGTGTCGCGCTGAGAGAACTAACTGGCGGAAGCACAAGAACATTGCTGTCCGTAGCCAGCCGTTTAGCCGA
AGCCGGAGGTGTTGCAGGGTGGTTCAGGTCCATCCTTTCGCTGAACGTTGACTCGCGTCGTGTGCAGGCAATACCCGCCCCGGACTGGTGTACCCTCCTG
CGATTTGAACGAGTTGATGCATGAATCGTTGCAGGTTCAAGCACTCTGTGAAGACTGCTCTCTGGTAGGAACCGATTGATCCACCAGTGCTTAGCGTAAT
GTTGGGGCAGAAGCTGATTTCGTCGATTAGACTCAATGATTGTAATAAGTTCGTGTAAGTACGGCCGCCCATGCACTACGCGGAAGCAACCATAGCATAC
ATCGCGTTGTAGTCTGTTGAAAACGATCTTGAACGCATCCCGCCACAATGTCTCCGTTGCCGTCAGTGCGTAAACACTGATAACCCGCACCACAGCAGAA
TTGTGGCTTGGCTGCAAGAGGAAATGTGTGATGACAGCATTGCGTGGTGACAGCAGTCTAGTGTCCGACACGGCGCCTTCCCACCATGGTAGAATACTCT
TGTACACAGTGAACAGATCTCCACGACTGCTGCGAAGCCACGTCTTGCATTTAGCATGTGTGTCTTCAACAATAGATGTATCCCGGACTCCACAATGCGG
ATAGCTGTCAGTCCACGCCTTCATAATCCTCTCCTTGTAATTCCACCAGTTCGTGTCAAGGTAGGCAGCCAAGTACAAGCTGTGAGATTTCAGAGAAGGG
CGTACGGTCTCAAATTCAGTCTCTCTCTTCGCGTCCACAGCCATGAAGAACGACGCCATGAATGCGTCTGTCTCCCACGTGTTTTCCTTTCGGGTAAGAC
CCGTGAAAGGGTCGACGACAGAAACCTGTCCAAGATGCTTTCGCCCCATCGTTTCGACGTTCTTGTTCATGTGCCAGCGACACACCATGGCATGTATGCT
GTCGAACACTCGGTCGACTGCGTTCATACACACTTGTTCGCGAGCGGTAAGGATTACCCCCGGCATAGTCATGTCCTTTTCAATCATGAAGAGGCGCAGC
ATGTTCAGAGCCCACACGTAATCTTCCTCCTTTTCACCTGGTAGCCAGCACTGGGCCACCGGCAGGGCAGTATTGAATCCTGTCACCGAGATGATGTTCA
GCAACGGAAACTTGTACTTGTTGGTTTTGTACGTACAATCCATGACGAGAACATCGTGGTGCCGACGGTACCAGCCAGCTGTTCTTGGATGGGCCCAGAA
AAGGTAGCGTAGTTCCTGCGTTTCTTCATTCACAGCGTAGCGCAAAAAGAAGCCCTGGCTGGTCAGGCTTGAAAAAAAATGCCTCCATCACGGTCTGAGT
TGACAATTCACGACGTCTCACCGCGTTTTTGGTGTTGGCAATGTCCTTTGGGATGGCATACGAGTTGGGTGAAGTCGACTGCCGTACCGCGTGTGGACAA
TCTCCCATGGTCCATGCGGATCCGCCTGGGATACAGCTTTGAGGAcgagcttcatcttgcaCCCCATTCGCTAGGAGCCTCGCATGGGACGCACTCGATC
TCCATCAGCaaggcgctgcgtctgcttcGGCGCGCCTGTATGGTCAAAGTCCAAGCCTCACTTCCAGACGATAGTCCTCGCCTCGTCAGTGTAGAACGCG
CGGCGCTTGGTCATGGTGAAGATGTGGTCTTTCGTCCAGCGATGGGCAGCTGCAAGCGCGGCAGCCTCGGACGGGAACGATTTTTCAGGTGGCGGCGGGA
TGACAAAGACCTCCACGATGACTTCAGAATTGGAGGTGCGCGGATCGCCACGAGCTTCCATTGCAGCGGCGAGGGGTGGAGAGTGGGGGAGTTGAAAGAG
GTGTGAGGCTGAGCTCAATTGCCGGAATGAAAGGTATAAGGAGCATGGTTAAAGTGAAAGCAACAGACTTGCCCAACGTTCACCATTCGTTTGGCTATGC
CGCTGTTTTACATGTGTCTTAAATCGGTATAGTCTAACCAGCTATTAATCGTGGTAATCTGGTATCCTGCGTTCTAGCCT