Description :
From Genome Similarity Track
Location :
contig_12:98976- 100017
Transcript NameFunction/comments
g3909.t1ETK86879.1 hypothetical protein L915_08569 [Phytophthora parasitica

Sequence
1041 bases(100 bases per row)
GCGCCTGCGAATTGAGTTTATCGATGAGCCAGGGTTGGACGCGGGCGGTCTATTGCGCGAATGGGTTCTGCTTTTGTGTGAGCAGCTCTTTGACGAGAGC
TACGGGCTGTTTCAGAGAACGCATGCTGACCAGTCTGGGTACTGGATCAACCCGAATTCACGGGAGATTCACCGTGATCACTTGCATTGCTTCCAGTTTG
TCGGGCGGTTGCTCGCAAAATGTCTTCTGGAGGGACAATTGATGACGGTGCACCTCGCGCTTCCGCTTCTCAAGCATCTTTTGGGCGTCCCGATCTCGTT
CTCCGACCTGGAGTTCCTTGACGCAGAACTGCATCGCCACGCACTTTGGTTACGCGATAACGAGGGTGCCGAAGCCCTCGCACTTGACTTCACAGTTCAA
CGGCAGGCAAATAATGGCACGGTCATCACTGAGGAGCTCAAACAGGGAGGCAAAGACATCCCAGTAACGGATGCCAACAAGGAAGAGTACCTGACCCTGT
TGCTAAGACACAAGATGTTCGCTGGAGTGCACGACCAGCTCGAGGCACTGCTTCAAGGACTGTACGACGTGCTGCCACGCACGCTTCTGGCTGTCTTCGA
CTACCAGGAGATGGAGCTCCTCTTGTGCGGCGTGCCATCAATCGACGTTGCCGACTGGGAATCGCACACCGACATCCGATACATGCGTGCTGAGCAGGGC
CTTAACAGACCCTCCAGTCCCGAACGTCAAGTCGTGCAGTGGTTCTGGGACGCTGTGCGTGCATTCTCCCAGGAAGAGCGTGCACGTCTACTACAGTTCG
TCACTGGCACCTCTCGAGTCCCCGCTGAAGGTTTCCGAGCGCTGCTCAGCCATGACGGTCGTATCCGTCGCTTCGGTCTTCAGATGATGCCCCTCGGTGC
GCCACCCACAGGCCTATACCCGAAAGCACACACGTGCTTCAACCGCCTCGACCTTCCTGTCTATCCCTCTTACCAAGAGCTCGAAAAGTACCTCACCCTC
GTCATCAACATGGAAATAGCAGGATTCACCATGCAGTAAAC