Description :
From Genome Similarity Track
Location :
Scaffold_778:9897- 12770
Transcript NameFunction/comments
Phypl_g10914hypothetical protein
Phypl_g10915hypothetical protein PHYSODRAFT_534407

Sequence
2873 bases(100 bases per row)
GTCGTCATTAGTGTCACCTTCGTGACCAATGTCACCAGGACACCGGTTAGCGGATTGCCTGCCGGCCCGCGTGTATCACGAGGCCAGCGGCTTCGATTCC
CCGGTATACAGCCGACCACGCCACGCATGGCGTGTAGTGacaccacgtcgtcgtgacAAATGTCACCTGTGTCGCCCACTGGGTTACCGGCCGCCCCGCG
CACAGCCCACGAGCCTTGCTCGGGATTCTTGTCCTCGACACCTTCAGTGTCTACAAGTTCGGATACTTCGATGTCCAACAGATTGACCGACTCGGTTCAG
TGTCCGCGCCAATAGCGCTATTGCTTCTTAACAGAGGTGGGTTCATGACTCACCAAAACCGATTTACCAGCATTAAAGAGCGTTGCGCCCAATACCTTCG
ACCTTCAATCAATTCACGGTTCAAGGCGTTCCTGTCATGCGATGCCCCGGTCGAGGTCATACCTCGAATCCAGGTACAGGACCAGGCAGCGTTCCACGCT
ATTAAAGTCGAGAAACGCCATGCCCAGGTCCACAGGGACCTTGGACACCCTGATGCAGGTCTCTGTCACTGGGCGAACAGTGACTATGTCAACCCTCCGC
GCTCCCAGCACCTCAGCGTACCGCTGACTTCCTTCCATTGTCGATCGTTGAGCGTAGTAGCCCGACGCTCCAGGATCGATCAAGGTGATCCACGGCTTCT
CAAATGCTTTCACCGTCACCTCAACGACAAGCAACCCCACCTTGGCTAAACGTTCCATGTTAGAGCATACAGCTCTCTCCGGTGCTGGTCCCTGCTTACA
TCCACCTCCATAAGGCTCAACAGAAATCAGTCCAAGTCCTTCCCCAGGAGGGCGTCCCGCGCCTACTGAGTGTCGCCGTTTCACCGCAACGAGCCGAAGG
CTTGTCTCGAGGCAGAGCAGTGGTTCAAAGGAACATGGCGCGACCTGCGCGACGGGAAGGTTGCCTTCAGATGAGTGATGCTTCCACAGGCTAAAAACCA
ACGAACGCCCATGTGCTGCTTAGCAACTTGAAtctcaacttcttcgtcttctgcatAGCTGAGGTCGATCGTCACCGGGTCGTGAGTATTCCCACATCGA
CTAGTTGTTGGCTGTCCTCTTCTTGATATTTTTTCAGCTGGGAGTTTATTTTACCCGACGTGCTATACGCTGTGTTTATATATAAAAAAGACTACGCAAA
CCGTTTTCGTGGCAGAGCAACGATCACAAATTTTAAACGATGAGCGAAACAATGAGCGCAGCGTGCATACAGGCAGGTTTCCCGTAATACATTGCTGTAG
GTCATTGTAAGCATTAGTCATGTTGAAAACTCCGTCGTACCATTTCGAAAGTGCTAGGCCCCAACTAGCAAGCGGCGCAATTAGGCTATGGTACAGTGTG
TCTGCACCCGTATCCACAGCTCGAACAGTGCCTAAAAATCGATTCACAATCTTTCCAGATGTGTGAGAAATAAAGCGAATACAATTGTCATATTTTCATC
ACGGCCTTCACAACTACCCTCATCAACCAGCAATCTATACTCCAAAATCATTGAAACGATCTGCGTCCATATAATATCAGCTGAGCATTGAATAAAGTGC
TGTTGAACTGTTATAGATGTATATTTGGCATTGTAGCCAGTTGCACTCACCTGGTGGTAGAACTCCGGCAGCCGCTTCTCAAGAAAGCTAATAACATCCT
GAAGGTTGTATGTGTTCACATAATCTTCCTGCTCATCATGTCCTCGAAAAGAAATGCGTTGCTTCGTTAAGGCACACATCTAAAACCATCGCAAGTCTCT
CTATTCTGGTGTCGTTAATGTTTTGTAGCTGATTTTGTCCGATACTGACGCTAGTAGATGTTGAAAGTCGATCAGTGAGAACTAGTTCAGTCATTTTGTG
TTTAGAGCCCGCATTCCCTACATGCCTCGCAAATCCATTCTTTGACTTGCATTATTCCAGTTGTTGAATTCAATAGATGGTTGACAGTACGGCGAAACCT
CATTATCCATAGTTACCACCGAGGTTGCGTGGTTATGTGGAAGAGCGCTTGCGCAGTTAGGCGGATAAAGTGGTATGGTGTAATCATTTGAGTACACCAT
GATCGAGATTGATCCCGATCCATGATCCCGATCCATGACCCCGATCCATCCATGACCGCGATCCAGATCAATATGGTGAAATCGTTTGGGCACGCCCCGA
TCCAGATTGAACCCGATCAAGATCGATATGGTACCAGTTTTAGGGTACATCAGCACCCAATCTGAATTGGGAGTCAGTTAGCTAGGAGAGGGGAGCTGGT
CAGCTGGGAGAGGGAGCAGGCAGAGAAGGAAAGGATAGGAAGGAGCTAAGGTACATAACGGAGAAAGATTTTCCTTTCAAGACACAAGTGCCTCTGGATT
TTGGGCTGGGAAGTATATTGGCCCtcccgacgaccaagacaccTAAGTCGcgcacggagaagacgcttcAGACCCTGGATCGCTTGGCCAggtcgccacc
ttctctccACTCAAAGCTCCCGCCAACAGGAGGCGGTAAGCACGGGAAGGACATCCCAAGGACACCCCCACGAGCTGAGCAAGGTATACCAAGACCCTAA
TCGACTCTACACGACGGCCAagtgaagatttccacgcggCTGTCGCCAACAACCCCCTAAGTACCGTCCACACAAGCTCAACTCAAGATCGCCccgacgt
cttcgccatcaAAGGAAAAGCGTAACCCGTCCAACCAACAGGTGCACAAGGTGAGAAGACTTCAGCCCCCACGGACGaacggagtaccccctccgtaaGT
TGGTAGTCTGGACAACCGTTGGCTAGCTTGGATGGCGTCAGCAATTTCGCGAtacctgctccgccacaatggt