Description :
From Genome Similarity Track
Location :
contig_36:98966- 104553
Transcript NameFunction/comments
g7447.t1hypothetical protein PHYSODRAFT_560674

Sequence
5587 bases(100 bases per row)
CGTCCACAGCAAGCAAATGCTGGCGGGCAACCATCGCCATGTTGTGCTCTTTGCCAACTGTGCATCTTGTCAACTACAAATTTCACAAACTCGCGCACAT
TTTCTCCAAAGTGCTTGTGCTTCACCAAAATATCGTCATCGTCGAACTTTGCTCGTATGTGATCAAGAAGACCCATCACGACAAGGCTCTGGAAACGTAA
GAGAAGCCCACTATGTAAAGGAGGAAGCACGACTGATGAGCTCACCGTGCCATTCACATAGTCTTCGACAAGATCATGGCCGTTTGGAGCGTCCAGTAGA
AATTTCATCAGCAGCGCAATTAACAGTCGCAGGCCACGCGCTGCAACCGTATGGTGCAAAAATGGGTCACTTCCGTTTGAGTCCGCTGCTGCCGCCTCCT
CTGCCAGCTCTGCTCGACCTACATCCACGCTATAATCAGTCACGACAACTTGTTTGTCCTGCAAAACTTGAATAATGTGTTCACGTGGATACGGATAGTG
CACGACTAAGTAAGCTCTCGCGGCCGCGCAAATCAACCGTGTCAACTCCTCCATGAACTCCAGCCGCATTTTCTCACTTCCCGACAAAAACAAGGCGTGC
AAACTTGGCATACTTTCGAAAATGTGCTGCAGAAAGTCGAGAACTTCAAGATGATAGATGTCGGTTTGATCGAGCAAAGTTGGCGGCACTGTTGTAGAAG
GTTTCACGCCATCTTGCTCCATTTTGATGCCAGGGAAATGTTCTTGACTCATCGCAGTAGATGTTGACTCATCTGTGGAGGGCTCCCCAGTGGTACTCAC
CATGGCCACAGGATCGTTGAAGTGGCGGCGGAGCAATATCATAATTACAATCAAAATACTGGAATTCACGATACGATCTCGCTGGACGTTCACTTCAAAA
TCCTTGCCGAGGTATTCATTGTCAAGTCGAATTTCATGAGGTATGCCATCGATCGGTGGCCCCAAGAGCGCACTGAATAGAGCGTACCACATCTTCTCGA
AGGGGAAATGCATCACGTTTGAATTCACCGCGACATTGCTGAAAACCGCGTGATTACACGGTAAACCCTGAGCCAACAAGCGATAGTACCCCTCTTTCTT
GAAAACATTTTCGTATCGTGGATTTCCAAGCAGCGTGCACAGCAGTCTCAGCGCTGCAATAACTGTTGATGGAGTAATACCAAATGAAAATTCGGTCTCG
TCACCTGGAAATAGGAAATATTCAATCCAGCGTAGACCCAGATACTTACGGAAACCTGTCAGTCGAGTCGCGCTTGGCAATTGCATTCGTGAAGCTCCAG
CACCACTCGTGTTACTTGACGCAGCAGCCATTTTGACTGCATTGCTAACACCCAACTCTATTACTGAGCTGTCCGGATCATCTTGGTAATCTTTGCTTTC
CTTTATATCCAGTTTTTGCACCGCCTTCAAGAGTGTTTCCAATAGAAGCTCCTGGATCTTGGCTTGATGCGAGATTAAATGTGCATTTACCCACTTTGTA
GGGCCAGGCTTCAATTCTGATACCTTTTGCCCTTGCTGTACGTTCCAACAATTACGATCTATTCTTTGAGAGCCCCTGGGACTTAGGCACAGTCTAGCTG
TAGGACTCGCAAGGGTATGCGCTTTAAAACGAGCACCATCTTCATCGCTTGCGTTGCGCCTTTCATCGTCTTCTTCCACAATGATTTCTTCTTCGGCAGC
TTCTCCCCTGTAGTGGCCAAAGCGTGGAGACAACGTGGCTGCAAGGAAGCTCGTTACGTCTGCAAAATTTGATTCCACAGTTGACTCACGATTGGGGCTC
GTCAAGCAAACCAATATTACGTCTACAATAACTCGTAGAAGATCGACCGTGACGGTTGCATCCATTAGAACGTAAAGTAACTGCCGGATGAAGCTCATTG
ATTGCAGCTGTGCTCGATTTCGTTCACGAATCGCCTCGTCGTCAGCAGCCAAGCACGAGTAAAGTGTTGAAAAGAGTACCTTTGCAGTATCCACACCAGG
CGCCTTCTGCCAGAGTGAGTAGTCCAGAACAAAGTACTGCAACGCTTGCACATTACGGATCGCACTGTCCGGGGAAATTTGAGCTATCGTTTCCAATTGC
CGTTCTGGCTTCTCTAGCTCGATTTCCACACCAACAATACGAAAAATAATCTGTAGGCATGTGGTGTTTAAAACGATGCCTTCTTGTGTAGAAGATAGTT
CACAACGCCATAGCCATGATCATACTCCATCGCTGCCAGATTGCGCGAGTCACCTTGCATGAAAAGCCAGAGTAGACTGAGAGCCAACTCCACTTCCTCG
TCTGTCGAAGCTTCGTCTAGCAGCCCGTACGCAATTTGACACCCAGAGCTACTGATGTCGAACATGGCAGATGCCATTGTCGCGGCCTCACACAGCACAG
TCCCTCCCATGAGATGCCCACTTGGACGACCATCAAGCCTACTGTTGGGAATAATCAGCAACTCGTTCGCTACTCCATTTCTGGCTGAGTATGCCACCAC
AATCCTTTCAGACGGGACGGGAAGATGGATCAATGGCACAGCGCTAGGAATGCGAGAAAAGACGTTAGCACTTAACTTGATATCCTGGACGATAGCTGCA
GCCGTACTCGATGCAGCTGAAGCAAGCGATAAACTCCGGCGGAGAAGCTTGTTACGCCCACTACGCTCAACATCGACGGAATCGATAAGCGACCGAACAG
GGTCCCACATGTATGAATCAAGCACCTCCATGTTCGTTATGCTCAGATGATCAAATGTAGCCGCGATTTCGTTGTTTCCAGCAGCGCCGAAGAATAGCCG
GTCGTAGGATGGCCCCGCTGCGAACACGGCATTAACCACTGGCGCCGAAACTGGTAGGTCAAGCAAGTAAAATGGCCCTACCATCCATCTCACACTGGAA
CACCGACGAGCCTGAGATGGCACGCCTAATAGCCCACTTAGTGGCTGGCTGCCCGAGATGCTGGACGGATATGAAATCTTTACATTTTCCTGCAAAATCC
CATTCAAGTAGCAGGAACCATGCTGGACTGGAAGCGCTGCTTAGCATGAGTGAAAACGACGTGATGCCATTGCCTCGTCTTGATTGGCGTATGCGAAAAT
TGGTAGACTGAGGCGCGGTTTGAGCTCGTTCGCATGTAAAGCTTCCCTCCTTTTAGAAACGCTTCACTAACCGACTTGCCGTCGCTTGAGCGCAGTCGAA
AGAGATAGAACATTGGTGGATTGCAAACGACGCACTCACCGCCACTGTTCAGAAGCGCCTCAACGCATCCTCGGCACGCTCGGTGGGAACATTTCAATAC
ATACTCGTCCTGCACTTTTCCGCGGCAATGAATGCACGTGTTCGACATAAAACTCTCGGTATAGCTTCTCACGCTCCTCTTTTCGTTCAAACGAATCCAC
TCGAAACCATACCATGACCGAGTATCCATCGGGTGGAGGCCAAACTTTAGAGTTATGTGAAAAAGTTGATAAAGATGGCGCAGATGTACCAGGCTCGATT
GAAGACGCAGACCTGGCATTGATATCGGGGATTTGAAGACATCCGAATCCTTCCCTTGATACGTCAAACTCAATGGCAGGCGCTCCCTGTGTGTGATCAA
ATGTAGCCGAAGTCAACTTCAACAACAGTCTCATCAAAGTCGGAATGGGGGTTGCAGGTGCCTCCTTCACCAAAACGGGGGTGCTCTCCTTTGTTGTTCG
AGAATCCATAGTTTTTTGCACTCTCGACTTCAATCGCGACAAATGTTCCGCCTTCCTCCATTTTGTAGACTGTCGTCGCCGATCGCGGCACAAAGACATC
AGCATTTTAACCCAGTAGTTTGCCGCTGATAGAGAAACACTAGCAAGAGCGACGTTTTGTACAAGAGAAACAGCGAGTTCATGAAACGGGTTGCTTTCCC
ACAGCAGCGCTTGTGAAAGCAAGCTTTCGTTCGACTCGAATAATCCTTTGGTGTTGCGAGATGCTGCCGTAAAGGATTTCAGCAAGATCTCTAAAATATT
AGCAGACGCCAGGCGATATGAGTTCCCGGGGCTGAATCAGCACACAAGTGTCAGTTATACACCAGAGAATCGAATCAGCCAACACATGGGCAGTGAAAGC
AGCTTTCACGTACACTGTCGAAATACGTATGAGGACGCCCATCAGTTGTCGTGTAGAATTCATATCGAGCTCTCCAGCCCAAAGACTCATAAGCTGGATC
GCAACAGCAAACAATTGAGGGTAGCGCAAAGCAGCCGAGCAACATCCATCTATCGGCAGTGTCGAGGGTGAAGAAACGTTTCCGCCAAGACAAGTCATCT
CATAATCTCCCACTGAAAAACCAATGCAGTAACAAACACAAAAAAAGACGAGTGCATCTGCTTCCAAAACGTCACCACCGCTGCAGCTTTGGAAGCATTC
CTTGCTACGGATCCATTTTTGTAGTGCGAGAGTAAGCTACCGATTAAGTCACCAAAGGTACCGAACGAAATTGAGCTGGAATAACAAAATGGTGAGTGTG
AGAAGCAAGACAGAGTACTACTCAAGAAATCGTAAGCGATGCATACCTGAGAAATTGTCGCTCCGCTTCCTTGTTAGTCGTAACAAGAGAAAAAATCGAC
TGCAACGACAACACCATTGCAGAGCGAGCGTTGCCATCATCGACGTCGTTAATAGCGCCAGCAGTAACCTCCCACTTCTTTGCCACCGCACACAACGTTC
CAAGCAGCGATAAAATGATATCGCAATCCAACAAAGCATCGAAAACTCGACCTCGCTCGGCCTTCGCATAAAGAGAAACTTTGCTCACTGCGACGAGCTC
CGTACTGCAGTGAACTCGCCACAGATGAATTGTTGGAACACACTAGTGACTCGAGATACGCAAGTGCTCCTTGCAATACGGCCAGATTTCCTGGAAATGC
TAGCGTGACTTCTCCATCCTCCGGGAAGTAGACTGCCAGTGTTACGTAGCGAATAGCTTGCAAAAGGCTGTTGACTACGTTGCGGAGAACTTCATCGCCA
CGATGCAAATCCAACGATAGCCGGACGATGGATCCCCATAATGTAAGACCCTCCGGCTGAAAAGAAATATTTCCAATCAATTCGCAAACGCACTCGAGCA
TGGGTAATCCGCACAGCGTACGCTCAAAGTACTTCCTGCATAGTGATAGTATCACCGTGGACTCCATCAGCAAACAGTTTCATGATGTCGACGAGAACAA
GGTAATCCGTTCGCCCCATCGCACTACGGCGCGGACCGCACCGCCGTGCTCTTTGATGGCAATGTGGTGCCAACAAAGAGACGATTGCATTTTCATTAGC
GTAAGCCGGATCGCTAAACGTATCATCTGGATGACCACCACCGACTGCCCGTGTTGGATATTCCACCCTGATTTGGGTTGACGCTGCATCGGAGCAAATA
GTGTGTGTCTGATCGAGAAAGAGCGCCACCAGTGTACTCACAAGACCAACTGAGCGAAATACTTCGTGGTATGCATCGTCAAACCGAAGCAAATTCGCAC
CGAACGCGAGCAGAGCATGAATGGAGCGTCTTTGAAATGTATCCTGTTTGGCAAAAGCTAAGTTAACGGTTGGTATCTAGCATACGT