Description :
From Genome Similarity Track
Location :
contig_36:98959- 100665
Transcript NameFunction/comments
g9163.t1hypothetical protein

Sequence
1706 bases(100 bases per row)
TGTTTAGCTTTTCAGAAAGCATTTCTCCAAATGATGAAGGCGAAGGGGCCGCGAGTGAAAAAGAACTACTCCCGTCAATACCAGCAAGCCCGACAGTCGT
TCCACTCAATACAAAAAGAACCAGCTCTAGTAACCGAGACGGACCACCAAGGAAATGTGCTCGTCCACAGCAAGCAAATGCTGGCGGGCAACCATCGCCA
TGTTGTGCTCTTTGCCAACTGTGCATCTTGTCAACTACAAATTTCACAAACTCGCGCACATTTTCTCCAAAGTGCTTGTGCTTCACCAAAATATCGTCAT
CGTCGAACTTTGCTCGTATGTGATCAAGAAGACCCATCACGACAAGGCTCTGGAAACGTAAGAGAAGCCCACTATGTAAAGGAGGAAGCACGACTGATGA
GCTCACCGTGCCATTCACATAGTCTTCGACAAGATCATGGCCGTTTGGAGCGTCCAGTAGAAATTTCATCAGCAGCGCAATTAACAGTCGCAGGCCACGC
GCTGCAACCGTATGGTGCAAAAATGGGTCACTTCCGTTTGAGTCCGCTGCTGCCGCCTCCTCTGCCAGCTCTGCTCGACCTACATCCACGCTATAATCAG
TCACGACAACTTGTTTGTCCTGCAAAACTTGAATAATGTGTTCACGTGGATACGGATAGTGCACGACTAAGTAAGCTCTCGCGGCCGCGCAAATCAACCG
TGTCAACTCCTCCATGAACTCCAGCCGCATTTTCTCACTTCCCGACAAAAACAAGGCGTGCAAACTTGGCATACTTTCGAAAATGTGCTGCAGAAAGTCG
AGAACTTCAAGATGATAGATGTCGGTTTGATCGAGCAAAGTTGGCGGCACTGTTGTAGAAGGTTTCACGCCATCTTGCTCCATTTTGATGCCAGGGAAAT
GTTCTTGACTCATCGCAGTAGATGTTGACTCATCTGTGGAGGGCTCCCCAGTGGTACTCACCATGGCCACAGGATCGTTGAAGTGGCGGCGGAGCAATAT
CATAATTACAATCAAAATACTGGAATTCACGATACGATCTCGCTGGACGTTCACTTCAAAATCCTTGCCGAGGTATTCATTGTCAAGTCGAATTTCATGA
GGTATGCCATCGATCGGTGGCCCCAAGAGCGCACTGAATAGAGCGTACCACATCTTCTCGAAGGGGAAATGCATCACGTTTGAATTCACCGCGACATTGC
TGAAAACCGCGTGATTACACGGTAAACCCTGAGCCAACAAGCGATAGTACCCCTCTTTCTTGAAAACATTTTCGTACCGTGGATTTCCAAGCAGCGTGCA
CAGCAGTCTCAGCGCTGCAATAACTGTTGATGGAGTAATACCAAATGAAAATTCGGTCTCGTCACCTGGAAATAGGAAATATTCAATCCAGCGTAGACCC
AGATACTTACGGAAACCTGTCAGTCGAGTCGCGCTTGGCAATTGCATTCGTGAAGCTCCAGCACCACTCGTGTTACTTGACGCAGCAGCCATTTTGACTG
CATTGCTAACACCCAACTCTATTACTGAGCTGTCCGGATCATCTTGGTAATCTTTGCTTTCCTTTATATCCAGTTTTTGCACCGCCTTCAAGAGTGTTTC
CAATAGAAGCTCCTGGATCTTGGCTTGATGCGAGATTAAATGTGCATTTACCCACTTTGTAGGGCCAGGCTTCAATTCTGATACCTTTTGCCCTTGCTGT
ACGTTC