Description :
From Genome Similarity Track
Location :
Scaffold_344:9894- 11328
Sequence
1434 bases(100 bases per row)
CCCGTCACACCTGGTAGCACTTTGTAGTCCGTTCAAGGACCGCAGCCCCCGCATCCAACATGAACATGTTGGATGATGATGGTGACAACTTTCACATTAC
GCGTGAAAGTTACTCCGATTTGAGTGACATCCAATGGAGTGCGGTCGAACCCGCCGTCTATGCCATGCTGTCCGCACTGGACAAAGATGAGCAGCATACC
GCTGTCGCCAATCTCATACAACATGACCTTGACGAGTCACGAAAGAAAGTAACCTTGCTTCACCAGCAAGGTTCTCAACAGGAAGAGCTGTTGAGACAAC
AGCAGGCACAGACTGCTGTTCCCGGGTCGACGCACGTGCGTCGCCCCGAAACTTTGAAGATAGACATCTCAAAGTACAGAGAATGCGAGAAAGATTCCCT
CTTGAATTGAACAACGCCGTAAGGGCTCGTCACATCGCTGATGAGCAATTGCAAGTTGCATTTACTCAGTAGAACTTGGAAGGACGTGCTAAACCTTGGG
CACTAGTTCACAAGTTGCACGACCCATACGTGTTTGGGTCGTTGGAGGTCTTTAGGACCCGGATTAGACAAACGTTTGAACTGCCACGGGCTGAGTTCAG
GGCTCGATCAGAGCTCCTAAAACTCAAACAGGTTAAGCGTGATGTGCACGCTTACGCCCAACACATACGACTCCTTGCGAGTTGCATTACGGCCAACCCG
GTCCATGAGCACACGTTGATTACGGTGTTCATGCAGGATCTTGCGGATGGTCCCATCAAGACCCACCTGTTCTGTTTGGAACTGGATACGCTAGAAGACG
CGATATCAACTGCGGAATAGGAAGACTTCAGCTTGAGACAGGCTCCTGCTAGTCCGGGTTCATATCGTCCCCAAAGACGAAAAAAAGTCGGAGGTCCAGA
ACCTATGGACATCTGTTATGTTGAGAGCGAGAGACCTTGCTCTTCAAATGCAATCGCTGTCAGAAACAAGGACACTTCACCTACGAGTGTAGTGCCCTAC
GCCCAGTTTTTCGAAACACTGAGTGAACCGATCGACAGTCCACCAAGAAGGGCTACGGACGCGGGTCCAACGTTGTTGTGAAATATCAACAACGGAGTGG
ACCGCAAAAAACGGTCAGGTTCAGTAGGGGCGGAGCGTCCTAGTGTCCAGCAACCCCAAAAGAATTTGCAAATCTCTTGAGGAAAGTTGCTCCAGACTCA
CAATCAGTGTGTGTCTCTGCACTTGGTGATGAGGTACTCCTCATCACCTTGAATTTGAAAGTGACAGAAGATTTGTAACTTCGTGCCCTAGTTGATTGTG
GGGCTTCGAGCAATTTATTCGTCGCCAGTCGCTAGAGGGTCGTAGCTCAAGTTCGTTGAGCGCAACACCCCTCCAACGAAGATGAAGGTGCGCCTAGCAA
CAGGCGCATCGACAACATTGATGAAACGTGTAGT