Description :
From Genome Similarity Track
Location :
scaffold_22:989365- 990789
Transcript NameFunction/comments
Plaha_PHALS_04649Thioredoxin-like protein
Plaha_PHALS_04650FOG: RCC1 domain

Sequence
1424 bases(100 bases per row)
TAAACGAATGCCTTAAGCTTCTCACGAGCTGCATGATAACGACTGTGCTGCCCATTACGTCACCTCTTGCCTGTCCTCGAACTCAAAAGAACGAACTTAA
GAATATGTGCAGGTGCAGAATAATTAAGTGCGTGATTTAATTCAAATCCTGAGCAGAAACGAAAGAGGGAGGAAAATTAGACCTCAAAAGCAGTGTTGGC
CCTTTTGAAATTCCAGCAACTTCAGCGAGGGAACAAGCCGTGAACATTTCTTCACACTCTTATGGTGTCGAGCAGGCGCGGCCTGCTCGAATTCAACAGA
CTGCATTAAACTAAGTGAGCGACGTCGGTCCGATCGTGTCCTTAAGTTTGTGGTCAGCCGGCTGAGGACGTGCTTCGTAAACGCACTCGACTATGCCATG
ACGCCACTATGCGATAGAATGAATCGTATTAGTTTTTGTCGTATTGAGTATCGATCATGAATatcttaaaaaaatgtatataccgcacttttttattttc
gcCAGTGATGCCGACATAATAGATTTTGGTTTTGTCGCCTCCAAAGCTGCTTTGAATGAAGAGTGTTAAACTGCTTACACCTTGAAATTTGCGTAATCTG
CAGTAACGAGATAAGAGTTTCAGCATTCCTATCTAATACATTAATTGACATACTGAAGCGGATAATTAATATTGGCTCTGTCGTCCTCAACCAGATCTAA
TTTCTGTTGTGCCAGCAGCTCGTTTGCATTAGAAAAATCGATATCGTCTCGATTTGTGAATCTGAGCAATAGCATCCAAACACCAGCAACAACTACATGA
AAATtggctttttcaaatttagCTTCAGAACGTACATTTTAACTTCTTTAGGGTGAGTGCCGTCGCCAGCGCAACCCGAGATACAAATGGACTTAATGTT
GACAGATTCTGTGAATGGAATAAACAAAATCAGCTCTGGGTCGTCTTCGTTGCTAGCCAAAAACCGGGAGTGGTCTTGACGCTCGTTTAAAGGCTTGAAC
GGGTGAGATACAGCCCGTGGGTCCAGCGCATTGAGCACCCGAAGTTTGCTGGTGTCGATGAAGGGAAAGAGGGAAACTCCGTCTGCATCTTCAACCTCAT
GGCTATGATCGTGGTTAGAGTCAGGGTCGTGACTGTGGTCTTGACTGTGGTCGTGACTGTGGTCGTGACTGTGGTCGTGACTGTGATCGCAGTGCTGCAT
TGGCTTGATTTCGATTCAGCTTTGGTGACGATTGGCTAAAATGAGCTGCAGATGCATCTCGATCTTAAGTCATGATAACAATGGGCTTTTTGAAGAGTGC
TATTCGCCAATGGACCGAAAATTCATGGCTGTCGACGGAGGAGATACCTTCACAATGGGTATTGAGGCTGATAGTGGAAAGGTTTTTGGATGGGGACGAG
CATTCTACGGCGAGCTGCTTGATG